1. The following DNA contains one transcribed region which includes 2 exons and
ID: 187468 • Letter: 1
Question
1. The following DNA contains one transcribed region which includes 2 exons and a single 10-nucleotide intron. The transcription start site, (+1, cytosine) and branch point (adenine) are lower case.
5’-CCCTCGAcTCGTAATGGAAAGGTGCGAGTGGGCaCAGGCGCGGGGAAAATGAGACTATTTGTAGCTGACCCTC-3’
(Part 1 of 2) Using single letter amino acid abbreviations, translate the mature mRNA (i.e., after the intron is spliced. Hint: if it doesn't spell a message, try again). Label amino- and carboxyl- termini.
(Part 2 of 2) An insertion mutation adds a cytosine to the template strand between the first two codons. Translate the new mRNA.
1. The following DNA contains one transcribed region which includes 2 exons and a single 10-nucleotide intron. The transcription start site, (+1, cytosine) and branch point (adenine) are lower case.
5’-CCCTCGAcTCGTAATGGAAAGGTGCGAGTGGGCaCAGGCGCGGGGAAAATGAGACTATTTGTAGCTGACCCTC-3’
(Part 1 of 2) Using single letter amino acid abbreviations, translate the mature mRNA (i.e., after the intron is spliced. Hint: if it doesn't spell a message, try again). Label amino- and carboxyl- termini.
(Part 2 of 2) An insertion mutation adds a cytosine to the template strand between the first two codons. Translate the new mRNA.
Explanation / Answer
This would be the pre mRNA (not mature). The transcription start site, (+1, cytosine) and branch point (adenine) are lower case:
cUCGUAAUGGAAAGGUGCGAGUGGGCaCAGGCGCGGGGAAAAUGAGACUAUUUGUAGCUGACCCUC
First we need to identify the intron and eliminate it from the sequence. We know where the branchpoint's adenine is, so we part from that: the branchpoint is 7 nucleotides long, and the adenosine is the sixth one, so the bold letters on the sequence are the branchpoint.
Introns have conserved consensus start and end sequences: They start with GU and end with AG.
The branchpoint is a sequence near the end of an intron (within the intron) that folds back and bonds to the begining of the intron (a G) during the splicing process.
The intron we are looking for is 10 nucleotides long, so this is the intron: GUGGGCaCAG (the branchpoint is in bolds).
The mature mRNA is:
CUCGUAAUGGAAAGGUGCGAGCGCGGGGAAAAUGAGACUAUUUGUAGCUGACCCUC
Then we translate the sequence to amino acids following the genetic code, the single letter amino acid sequence is:
1) (carboxyl terminal) MERCERGENETICS (amino terminal)
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.