Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

BMMAG BMMSG 525 Microbiology Problem Set 2. The problem set is worth 20 points,

ID: 187193 • Letter: B

Question

BMMAG BMMSG 525 Microbiology Problem Set 2. The problem set is worth 20 points, divided as indicated below for each question. There is partial credit possible only for question 4c. 1. Create a line diagram of a gene with the following elements: promoter, operator, ribosome binding site, start codon, end codon, open reading frame, start of transcription, rho-independent transcription termination. Start with the arrow provided. Label where appropriate. (4 pts). 2. Transcribe the following sequence, and indicate all of the start and stop codons in all six frames (2 pts). 5 AATGTTACTCGAGGGCTACTTAGCCACTAGGCTTTAGCCAGCG 3 3. Translate the transcription (mRNA) sequence of the longest ORF in problem 2 (2 pts). 4. Assume a substitution mutation occurred near the beginning of the sequence, so that the DNA sequence is now: 5' A GTGTTACTCGAGGGCTACTTAGCCACTAGGCTTTAGCCAGCG 3" a. What type of mutation has occurred (e.g. nonsense or missense, transition or transversion) (1 pt)? Does this sequence still have an ORF (1 pts)? b. c. Explain why or why not. (2 pts)? Assume a second mutation occurred, such that the DNA sequence is now: 5' AGTGTTACTCGAGGGCTACTAGCCACTAGGCTTTAGCCAGCG 3 5. a. What type of mutation has occurred (hint: it may not be the same as in problem 4) (1 pt)? b. if a peptide can be produced after this mutation, what is its amino acid sequence (2 pts)? The lac operon produces three proteins. From the genotypes below, state whether or not Lacz will be produced in the presence of allolactose and the absence of glucose (lacO is the primary loc operator). For a. through e. explain why LacZ will or will not 6. be expressed. (1 pt each): a. Iacl., 1ad, lacZ-, lach, lacA+ c. laci+, laco, lacz+, lacY, lacA- d. lacl-, laco, lacZ-, lacY+, lacA- e. lacI+, alco, laeZ+, laer', lacA+

Explanation / Answer

6 reading frames

For

5'AGTGTTACTCGAGGGCTACTTAGCCACTAGGCTTTAGCCAGCG3'

1ST FRAME:- 5'CGCUGGCUAAAGCCUAGUGGCAAGUAGCCCUCGAGUAACACU3'

2nd frame

5' GCUGGCUAAAGCCUAGUGGCAAGUAGCCCUCGAGUAACACU3'

3rd frame

5'CUGGCUAAAGCCUAGUGGCAAGUAGCCCUCGAGUAACACU'

For 3'TCACAATGAGCTCCCGATGAATCGGTGATCCGAAATCGGTCGC5'

1ST

5'AGUGUUACUCGAGGGCUACUUAGCCACUAGGCUUUAGCCAGCG3'

2nd

5'GUGUUACUCGAGGGCUACUUAGCCACUAGGCUUUAGCCAGCG3'

3rd

5'UGUUACUCGAGGGCUACUUAGCCACUAGGCUUUAGCCAGCG3'

Here underlined AUG and GUG are start codons and UAA and UAG are stop codons