1. You are working in a lab and have been given a project which requires that yo
ID: 182251 • Letter: 1
Question
1. You are working in a lab and have been given a project which requires that you clone the promoter of the "gene A" into the "multiple cloning site" of Vector X. You will then clone the ORF of "gene B", 3' to the promoter of gene A. Please answer the questions given below, based on the following information (all sequences are dsDNA, top strands are shown). The below sequence is the promoter sequence of gene A. 5'-AAGGCCGTTACCTAAACCCGTGTATAAATGACTTGCTTTCCCGCGTGACTCCTGCCATCATGCA The sequence given below is the multiple cloning site of vector X EcORI KpnBamHI HindIII Restriction endonuclease recognition sites and digestion sites (arrow) are shown below EcoRI: 5'GAATTC Kpnl: 5'GGTACC BamHI: 5'GGATCC HindII: 5'AAGCTT 3'TTCGAA 3 ,CTTAAG 3'CCATGG 3 CCTAGG Question la: design two primers which will allow you to amplify the promoter of gene A, and help you clone this sequence into vector X, after it is digested with Kpnl. Write the sequences of the primers below. Each primer should be 15 nucleotides in length Primer 1: 5' Primer 2: 5' You have cloned the promoter of gene A into vector X successfully. You now want to clone the ORF of gene B (shown below) 3 to the promoter A in the same vector. The start and stop codons are shown in bold font. 5-ATGCATG TAGGCATTCAGATCTTTCGATACGCATCAAAGCTCTTAGCTTATCTG ATG TAA-3 Question lb: design two primers that will allow you to amplify the ORF of gene B, and help you clone this sequence into vector X. Chose the appropriate enzyme/enzymes and design your primers accordingly. Write the sequences of the primers below. Each primer should be 15 nucleotides in length Primer 1: 5' Primer 2: 5'Explanation / Answer
Answer to 1a) Primers to synthesize Promotor sequence
Primer 1 5' AGGTACCAAGGCCGT 3'
Primer 2 5' CGGTACCTGCATGAT 3'
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.