Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

1. The following is a small stretch of nucleotide sequence from a bacterial mRNA

ID: 165958 • Letter: 1

Question

1. The following is a small stretch of nucleotide sequence from a bacterial mRNA:

5’ – GGGCCCUGAUGUAACAUAGAUAGG – 3’

A. What is the sequence of the DNA template from which it was transcribed? (indicate polarity).

B. Use the genetic code table in Fig 8.11 of your textbook to determine the amino acid sequences encoded by all three reading frames. Use an asterisk (*) to indicate any stop codons you encounter and continue translating beyond them.

Nucleotide seq: 5’ – G G G C C C U G A U G U A A C A U A G A U A G G – 3’

RF1:

RF2:

RF3:

C. Would the same information be encoded by the RNA sequence that is complementary to the sequence given above?

D. Considering that the RNA sequence is a fragment of an mRNA, answer the questions below and BRIEFLY (10 words or less) explain your reasoning. i) Could this RNA be from the beginning of a protein coding region? ii) The middle? iii) The end?

Explanation / Answer

A.the sequence of the DNA template from which the mRNA was transcribed is-:

3’-CCCGGGACTACATTGTATCTATCC-5’

B. 5’ -Glycine, Proline,*, Cystein,Asparagine,Isoleucine,Aspartic acid,Arginine-3’

D.

i) No.This RNA could not be from the begining of a protein coding region because transcription of mRNA always starts from AUG or in some cases GUG.

ii) From middle also it is impossible because no where, the triplet coden is AUG or GUG.

iii)The end coden is AGG, which is not also a start codon.