Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Part ll-Activity: Matching Homologous Pax6 Genes and Phylogeny K Mouse Pax6 gene

ID: 148842 • Letter: P

Question

Part ll-Activity: Matching Homologous Pax6 Genes and Phylogeny K Mouse Pax6 gene: Unknown species 1: Unknown species 2 Unknown species 3 Unknown species 4 GTA AATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA GTGTCCAACGGTTCTGTCAGTAAAATCCTGGGCAGATACTATGAAACAGGATCCATCAGA GTATCAAATGGATGTGTGAGCAAAATTCTCGGGAGGTATTATGAAACAGGAAGCATACGA GTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTA GTCTCCAACGGCTGCGTTAGCAAGATTCTOGGA AAGA Instructions 1. Using the mouse Paxo gene as a basdline, determine the similarity of the homologous genes from the unknown species a. For each unknown species, determine the number of nucleotides that are different from the nucleotides found in the mouse sequence. b. There are 60 nucleotides in each sequence. To determine the percent similarity, suberact the number of different nucleocides from 60, divide the result by 60, and multiply by 100 2. One of Dawin's main ideas was that evolution involves descent with modification from common ancestry. We know today tha the modification can be simply divergence in gene sequences. The diagram to the right shows a phylogeny for the organisms represented in the sequences above. The degree of similarity in gene sequences is representative of how long ago two organisms Mouse Human diverged from each other. In other words, organisms with Shark Fruit fly a more recent common ancestor will have a greater similarity in gene sequences than organisms that have a much more ancient common ancestor. Make a bypothesis for which gene sequences Squid listed above represent each branch of the phylogeny Questions 1. Explain the pattern in nucleotide variation you obscrve in chis exercise Is chere a nelationship berween 2. There is variation in nucleotide sequences, but the amino ackd sequences for the parcial divergence and Pas6 sequences sequence presened this case are identical between the five the amino acid sequence t species. Explain why nanural sclection might have favored conservation of 3. If covered earlier in your course, how could diferent nucleocide sequences resulk in the same amino acid 4. In de mouse/fly experiment that Madison rred to, the moun /a6pne is used in place ofthe gene (a copy of the homolog to Pex6; fruit flies have a protein that controls expression of odber genes. Explain how a mammalian gene can wuccessfully Induce development of a compound eye in frui fies two homologa). The gene codes for a transcription factot

Explanation / Answer

1) a.

Mouse: GTATCCAACGGTTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA

Sp1. GTGTCCAACGGTTCTGTCAGTAAAATCCTGGGCAGATACTATGAAACAGGATCCATCAGA

10 nucleotides are different in sp.1 from the nucleotides in mouse sequence.

Mouse: GTATCCAACGGTTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA

Sp.2. GTATCAAATGGATGTGTGAGCAAAATTCTCGGGAGGTATTATGAAACAGGAAGCATACGA

14 nucleotides are different in sp.1 from the nucleotides in mouse sequence.

Mouse:GTATCCAACGGTTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA

Sp3. GTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA

2 nucleotides are different in sp.1 from the nucleotides in mouse sequence.

Mouse:GTATCCAACGGTTGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGA

Sp4. GTCTCCAACGGCTGCGTTAGCAAGATTCTCGGACGGTACTATGAGACGGGCTCCATAAGA

13 nucleotides are different in sp.1 from the nucleotides in mouse sequence.

b) Determination of percent similarity:

Mouse vs Sp1: 10 (60-10) = 50/60 = 0.83X100 =83%

Mouse vs Sp2: 14 (60-14) = 46/60 = 0.76X100 = 76%

Mouse vs Sp3: 2 (60-2) = 58/60 = 0.96X100 = 96%

Mouse vs Sp4: 13 (60-13) = 47/60 = 0.78X100 = 78%

2. We can assume from the above sequences, that Sp.3 is human. As, it has maximum (96%) similarities with mouse. According to the tree and sequence similarity, we can say that Sp.1 is shark (83%), and Sp4 is fruitfly (78%), whereas, Sp.2 is Squid (76%).

1. The pattern of nucleotide variation is SNP (single nucleotide polymorphism). There are a relationship between divergence and Pax6 gene. Greater the divergence is, more SNPs are found in Pax6 gene among sp.

Please ask multiple questions separately.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote