1) a) Why would we use EcoRI AND PST1 to digest pUC18 instead of just one or the
ID: 148553 • Letter: 1
Question
1) a) Why would we use EcoRI AND PST1 to digest pUC18 instead of just one or the other? Also, why would using PvuI, XmnI or SspI be poor restriction enzymes to use for PCR subcloning of the pUC18 gene specifically? Is there anything special about the sequence, plasmid, dna vector and/or restriction enzymes that explains why? Please create an explanation that is as detailed as possible. Here is the diagram for reference:
b). Explain the results of the gel and why the markers are where there are in at least 5-7 sentences and answer the other below questions:
An Example Subcloning Strategy: 2,000 bp fragment Ndel, HgiElI Aatil Eco0109 EcoR Pst Pvu Pvull Avall1 2000 AÄTTCGATAT... 69 kb) AMIITAGACTGCAG CTTAAGCTATA... ATCTGACGTC 5' AATTCGATAT. .TAGACTGCA 3 GCTATA.. ATCTG Digest pUC18 with MCT GAAACAGCTATGACCATGA MetThrMetIleThrAsnSerServalProGlyAspProLeuGluserThrCyBArgHISlaserLeuAlateuAia.. Pstl he desired recombin ant product GAATTCGATAT. .TAGACTGCAG..3' CTTAAGCTATA.. ATCTGACGTC..5' Ligat 3 Accl GAAACAGCTATGACCATCATTACCAA TTCGAGCICGGTACCCOGCGATCCICTAGAGTCGAC ATOCAAGCTTGGCACIGG. MetThrMetIlethrAsnSerSerValProGlyAspProLeuGluSerThrcysArgHisAlaSerLeuAlaLeuAla Ndel, HgiEll Aatll Eco0109 Pvu Scal Why don'tI want to design a strategy: Using Pvul? Using XmnI? Using SspI? Pvull pUC18 (2.69 kb) Avall 2000Explanation / Answer
a)digestion of puc 18 with two different enzymes will lead two different restriction sites, hence when the insert will be digested with the two different enzymes it will be in correct orientation with the origin of replication of puc 18. If you digest it with just one enzyme both the insert and vector both will have one type of restriction site and thus the gene can reverse its orientation. Pvu1, ssp1 enzymes are poor choice of restriction enzymes because these enzyme sites lie within the sequence of ampicillin resistance gene if our insert get at this site, it will disrupt this gene and the resistance of the puc 18 to ampicillin will be lost which act a selection marker.
b) In the picture the insert size is of 2000 bp and 2.69kb. the marker is a control DNA which is digested into number of fragments, in which size of ech fragment is known. so when we isolate the DNA from purified colonies the DNA is run into agarose gel along with the marker. First lane is your undigested puc 19 vector and it is supercoiled. second lane consists of digested puc 19 vector with EcoR1 and Pst1 now the vector gets linearised and corresponds to 2.69kb size along with the marker. Third lane contains digested vector in which the ligation of an insert did not take place. hence it shows the size of 2.69 kb only. Fourth lane contains a DNA when digested with the enzymes gives 2 bands corresponding to 2.69 kb that is vector itself and 2000 bp that is our insert, it means that successful ligation takes place.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.