1. chromosome 17 of a hirsute, belligerent Canadian that you believe is responsi

Question

1. chromosome 17 of a hirsute, belligerent Canadian that you believe is responsible for his remarkably fast and scarless healing. You want to study the protein product of this gene, which you've dubbed the X-gene. Your plan is to PCR amplify the X-gene from a sample of the Canadian's DNA and insert it into a vector suitable for human cells. This vector has an EcoR1 restriction site to the left and a Pstl restriction site to the right of where you intend to place the X-gene out of 5 points) You've found a gene on We're going to PCR amplify the X-gene from our sample of mutant DNA, editing in the appropriate restriction sites as we do. (The chromosomal DNA, like most DNA we sample from nature, doesn't have convenient restriction sites at the right and left of the sequence we're interested in.) The portion of the DNA on chromosome 17 with the X-gene in it is shown below. The referencee strand is on top and the complement strand below, as usual. ,-. . . ggogect togggaaagggtaggetaagact(XGENE] gatgatcagtaagctat tcgatctctggcgog. . .-3 3 ,-. . . cogoggaagccct t tocca tocgatto tga [XGENE ] ctac tag toat toga taagotagagaccgogc···-5 , Design the right and left PCR primers (which must be written 5' -> 3) that you would use to amplify the X-gene from the sample DNA. These primers should * have 20 base pairs that are complementary to the DNA in red . introduce EcoRI and Pstl restriction sites into the PCR amplified DNA that will produce a cut at the location with underlined bases in the blue DNA, and allow you to eventually insert the X-gene into the plasmid above * have five extra bases after the restriction site on the 5' end exactly what bases those are isn't critical, so you may call them NNNNN

Explanation / Answer

Hi
The PCR base cloning solely relies on the design of primers. A typical primer for cloning consists of
- Leader sequence: Extras bases on 5' end to assist digestion by restriction enzyme
- Restriction site: Site with recognition site for restriction enzyme
-Hybridization sequence: PCR binding site of region to be amplified

The primers will have the hybridization sequence as given in red color in question.
forward primer will have same sequence as forward sequence and reverse primer will have reverse complement of the complement sequence.
Forward primer = 5' ggaaagggtaggctaagact 3'
reverse primer = 5' gcattatcgaaatgactagtag 3'

Now lets add restriction sites to 5'end: EcoR1 - GAATTC//CTTAAG
PSTI: CTGCAG/GACGTC
Let us add this region to 5' ends of both sequence:
5'GAATTCggaaagggtaggctaagact 3'
5'CTGCAGgcattatcgaaatgactagtag 3'
(in reverse primer everything is reverse complemented)
We need to add 5 - 6 bases upstram of 5' end for better digestion by enzyme.

So final primers are :
forward: 5' NNNNNGAATTCggaaagggtaggctaagact 3'
Reverse: 5' NNNNNCTGCAGgcattatcgaaatgactagtag 3'

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.