One of the building blocks of DNA is a phosphate group, and the pKas of phosphat
ID: 142165 • Letter: O
Question
One of the building blocks of DNA is a phosphate group, and the pKas of phosphate groups are very low (-1.0). Gel electrophoresis is performed with a buffer at a specific pH, typically pH 8. Given what you know about DNA and about gel electrophoresis, why do you think the buffer plH is important? (2-3 sentences). (1 point) C. these While all bacteria and eukaryotes use double-stranded DNA (dsDNA) as their genetic material not all viruses have dsDNA. Some viruses have single stranded DNA (ssDNA) and some have single-stranded RNA (ssRNA). Before DNA sequencing was a routine method used to analyze nucleic acids for their base composition by determining the concentration of different components. Suppose that a biological sample was isolated from a deep sea vent, with the following results. Fill in the rest of this table. If some part cannot be answered, explain why. (1 point) 5. Type of genome dsDNA Organism %A %C %G %T %U Bacteria Virus Virus 23 29 21 26 6. Consider the following linear, double stranded DNA sequence: (1 point) 5TAGGAACATGCGACGTAAGACAT3' 3'ATCCTTGTACGCTGCATTCTGTAS A. How many hydrogen bonds are there between the two strands? B. How many phosphodiester bonds are there in this molecule? C. If the molecule was circular rather than linear, how many hydrogen bonds would there be? D. If the molecule was circular rather than linear, how many phosphodiester bonds would there be?Explanation / Answer
C) Phosphate groups have pKa ~1 which means at pH= pKa= 1 it will give up a proton to become negatively charged and both ionized (negative charged) and deionized (uncharged) forms will be present in equal amount. At a higher pH of 8, all the phosphates will be completely ionized i.e negatively charged by losing a H+ ion. The negatively charged DNA can migrate towards the anode at ph8.
5) percentage of Cytosine is equal to guanine as C pairs with G. So G= 23%. The percentage of adenine equals to thymidine and sum of purine (A+G) and pyrimidines (T+C) is equal to 100%
(A+G) + (T+C) =100%
A + 23 + T + 23 = 100%
A+ T + 46 = 100%
A+ T = 100 - 46 = 54%
Now percentage of T equal A
A + A =54%
2A = 54%
A =27%
A =27% , T =27%, G= 23%, C= 23%
In virus in the second row it cannot be determined if its single stranded or double stranded as percentage of bases C and T is not given. According to chargaff rule if percentage of A = T and G=C then its double stranded and if not then its single stranded. Also Its not specified if it contains T or U. In such case the nature of nucleic acid whether RNA or DNA can also not be determined.
Virus in the third row is RNA virus at contains Uridine base which is only present in RNA. Again the percentage of other bases is not given, therefore we cannot determin if its single stranded or double stranded.
6 A) G pairs to C via three hydrogen bonds and A pairs to T via two hydrogen bonds.Number of GC base pairs = 10 and number of AT base pairs = 13
GC has 3 hydrogen bond and AT has 2 hydrogen bonds
Total number of hydrogen bonds = 10x 3 + 13 x 2
= 30 + 26 = 56
Total number of hydrogen bonds is 56
6 B) Each nucleotide is bonded to the next one via a phosphodiester bond. Like in the top strand starting from 5' end T is bonded to A via single phosphodiester bond and A is then bonded to G via a single phosphodiester bond and so on.
Top and bottom strands have 22 phosphodiester bonds each .Total phosphodiester bond in the molecules are are 44
C) Number of Hydrogen bonds would be same as the base composition would remain the same even in circular form.
D) 1 Phosphodiester bond would increase on each strand as the 5' and 3' end will be connected. The total number of phosphodiester would be 44 + 2 =46 in circular form
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.