Molecular Genetics, Assignment for Chapter 2 A table showing all of the 64 codon
ID: 142087 • Letter: M
Question
Molecular Genetics, Assignment for Chapter 2 A table showing all of the 64 codons and the amino acid for which they code can be found in your book. Below is a Prokaryotic DNA sequence with the corresponding protein sequence for each of the three forward reading frames. Note that in this case, Z, represents one of the three translational termination codons. In prokaryotes, transcription starts at promoters that are most closely related to a -10 region of TATAAT and a compatable-35 region. Transcription terminates at stem-loop structures that can form in inverted repeat regions. Translation starts at AUG codons corresponding to the amino acid M. Adjacent to the starting AUG, 8-10 bases upstream (i.e., to the left), you will find a ribosomal binding site AGGAGG which is complementary to the 3 end of the 16S rRNA. Find the transcription start site, TATAAT, and circle it. Find the ribosomal binding site and draw a box around it. 3. 4. Find the adjacent AUG and record the protein sequence below, adjacent to the word "Protein Amutation at base 115 converts the C at this position to an A. Write the protein sequence for the mutant next to the "115 C>A" line below. Record the protein sequence that would be made when a C is deleted at position 120 next to the "120 Delete C" line. Record the protein sequence that would be made when a G is inserted at position 125 into the mutant described in 5. Would this protein be functional? 6. 7. What impact would a T>G substitution have at position 40 of the original sequence? 4uG 30 40 6PA 50 70 80 90 100 110 H120 130 140 150 160 ATCATTATGATTACAAG 170 210 ACTTGTTGTTIGTTAACGATTTGTAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTAACG 180 190 220 230 240 APFAEPTCcLLTICNZRLLLEPFFLT ssPCRAD LLPVNDL2LKAPFGAF FFN D /- Protein M AUG 5 120 Delete C uub +125 Insert Ga Would it be functional? yes 7-T G@ base 40 would result in wExplanation / Answer
1) The transcriptional start site includes the sequence TATAAT.
2) The ribosomal binding site is at the position 55-60. It includes the sequence AGGAGG.
3) Protein - AUG starting codon for the amino acid methionine
4) The protein sequence will become AUU.
5) When C is deleted at position 120, the next protein sequence that can be made is UUG.
6) When G is inserted at position 125, the sequence that can be made is GGG.
7) Substitution of T with G at position 40 would result in a ribosomal binding site.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.