Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You are examining the phylogenic relationship of a newly discovered plant specie

ID: 141622 • Letter: Y

Question

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode and sequence the DNA. After entering your sequence into BOLD the following comparison comes up.

Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAA Species

2. ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

What DNA modifications have occurred in Species 2 that makes it different from Species 1? See figure 12.14 in your textbook for help. Check all that apply.

o Deletion

o Duplication

o Inversion

Explanation / Answer

2) What DNA modifications have occurred in Species 2 that makes it different from Species 1?

B) Duplication

C) Inversion

Nucleotides A and T duplicate. Inversion occurs in CAT position which becomes TAC in species 2.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote