You sent off a sample for sequencing in order to aid in prescribing the proper t

Question

You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

Describe the complete process, step by step, that this protein plays a role in.

Explanation / Answer

Ans: The sequence seems to be proteins involved in DNA supercoiling, especially DNA topoisomerase II. Mutations in this enzyme may result in improper dna packaging and chromosome nondisjunction in meiosis or mitosis during sister chromatid separations. This may lead to many diseases and syndromes.

Processes and steps involved in topoisomerase II function.

With the help of ATP these enzymes cut both the strands of the DNA. Once cut, the ends of the DNA are separated, and a second DNA duplex is passed through the break. Following passage, the cut DNA is re-ligated . This reaction allows type II topoisomerases to increase or decrease the linking number of a DNA loop by 2 units, and it promotes chromosome disentanglement. General mechanisms of topoisomerases are: a strand of DNA, called the gate, or G-segment, is bound by a central DNA-binding gate (DNA-gate). A second strand of DNA, called the transport, or T-segment, is captured by the dimerization of the N-terminal ATPase domain (the ATPase-gate) when two molecules of ATP bind. Hydrolysis of ATP and release of an inorganic phosphate leads to the cleavage of the G-segment, as the catalytic tyrosines form a covalent phosphotyrosine bond with the 5' end of the DNA. This creates a four-base overhang and a double-stranded break in the G-segment. As the DNA-binding gate separates, the T-segment is transferred through the G-segment. The G-segment is sealed, leading to the C-terminal gate (or C-gate) to open, allowing for the release of the T-segment. Release of product ADP leads to a reset of the system, and allows a second T-segment to be captured. Catenation is the process by which two circular DNA strands are linked together like chain links. This occurs after DNA replication, where two single strands are catenated and can still replicate but cannot separate into the two daughter cells. As type II topoisomerses break a double strand, they can fix this state of entanglements, if not removed sister chromatids cannot separate and one cell may receive both the sister chromatids and the other cell none.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.