Q1) Answer A), B), C), D), E), F), and G) A map of the trpB-containing region of
ID: 133326 • Letter: Q
Question
Q1) Answer A), B), C), D), E), F), and G) A map of the trpB-containing region of the B. subtilis chromosome is shown below Re-draw this map in your answer booklet and use the diagram to answer your questions. All sections of this question pertain to this map (Total Q1): 19 marks) 0.3 kb trpC trpB 1.8 kb 0.5 kb 1.2kb 0.8 kb A)How many transcripts are made from this region of the chromosome and which gene/s are on the transcripts? Explain your answer with reference to features shown in the diagram. You may simply draw your answers onto the map if you (4 marks) wish. B)The coding sequence of the trpB gene is shown below. It is drawn according to the usual conventions for DNA sequences. What are the first four residues of the TrpB (3 marks) protein? ATGAATTACG CATATCCAGA TGAAAAAGGT CACTACGGTA TATACGGAGG ACGATACGTT CCAGAAACGT TAATGCAATC TGTATTAGAA CTAGAAGAAG CATATAAAGA GGCGATGGAA GATGAAGCAT TTCAAAAGGA AGGAATTATC 900 bp of sequence is omitted from this area for simplicity CCGGCGTTAG AAAGCTCGCA TGCTGTCGCA TATGCATTAA AATTAGCGGC GCAAATGAAG AAAGACGAAG GGCTTGTCAT TTGTTTATCT GGCCGTGGTG ATAAAGATGT AGAGAGTATA AAACGTTATA TGGAAGAGGT GTAA C) Design a reverse primer that could be used for the amplification of this gene assuming that you wish to amplify the entire sequence, rather than just a fragment of the sequence. Write the primer sequence in your answer booklet and label it (4 marks) trpB REV D) On the diagram label the 5' and 3' ends of this primer (1 mark) E) What temperature would you use for the annealing step of a PCR that used this primer? Justify your answer (2 marks)Explanation / Answer
A) As the figure suggests, there are three transcripts made from the given region of the chromosome named TrpA, TrpB and TrpC. The size of these genes is 1.2kb, 1.8kb and 0.8kb respectively. the transcription of TrpB and TrpC is taking place which shares a common operator region.
B) the first four amino acid residue of Protein TrpB will be Methionine-Asparagine-tyrosine-Alanine
ATG encodes methionine
AAT encodes Asparagine
TAC encodes tyrosine
GCA encodes alanine.
C), D) and E) the reverse primer will be the complementary of the 3' end of the coding sequence which is as follow
TrpB Rev : 5' TTACACCTCTTCCATATAACGTTT3'
the basic temperature of the above primer can be calculated as (4 x no of G and C)+ (2 x no of A and T) which is near by 50oC, however, the salt present within the primer will have its effect on annealing temperature so near 52oC will properly anneal to the template which can be confirmed by gradient PCR.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.