Browse C

C++ Classes and Objects How can I implement this in the main()? --Create a progr

C++ Classes and Objects How can I implement this in the main()? --Create a program that creates two Account objects and tests the member functions of class Account. How can I impl…

C++ Classes question. Not whole program. no int main! Write the implementation (

C++ Classes question. Not whole program. no int main! Write the implementation (.cpp file) of the Acc2 class . The full specification of the class is: An data member named sum of …

C++ Client program Data file Correct output Reduce Fractions Add a private \"sim

C++ Client program Data file Correct output Reduce Fractions Add a private "simplify()" function to your class and call it from the appropriate member functions. (There will proba…

C++ Code 1) Create a linked-list class that holds employees. • Create a new poin

C++ Code 1) Create a linked-list class that holds employees. • Create a new pointer within the linked list class called ‘currentPtr’. This will be a position pointer which points …

C++ Code 2. Add a method in “AVL_tree.h” as follows. (40 pts) bool immediate_pre

C++ Code 2. Add a method in “AVL_tree.h” as follows. (40 pts) bool immediate_predecessor(Record &key) const; The method looks for the immediate predecessor of the input key in…

C++ Code : Problem A: Birthdays again... ( this code most be written in C++, Tha

C++ Code: Problem A: Birthdays again... (this code most be written in C++, Thanks) Write a program that opens a file of the users choice that contains a list of birthdays. Extract…

C++ Code An instructor at the university needs your help. He has a file with the

C++ Code An instructor at the university needs your help. He has a file with the students’ ID, assignments, exam1, exam2 and final exam. You need to implement a program to take th…

C++ Code Cleanup/Fix- Can\'t Get Through the Errors. Help please. #include

C++ Code Cleanup/Fix- Can't Get Through the Errors. Help please. #include <iostream> using namespace std; class COP { public: COP(); Node(); Node(const sender+orig); Node(co…

C++ Code Complete the following linked list implementation of STACK in C++ to in

C++ Code Complete the following linked list implementation of STACK in C++ to include two other member functions int peek() and void flush(). Function int peek() returns the top e…

C++ Code Consider the LinkedList class and the Node class that we saw in lecture

C++ Code Consider the LinkedList class and the Node class that we saw in lecture. The LinkedList class basically represents a singly linked list. Now, for this lab, consider a dou…

C++ Code Create an unordered linked list of (at least 5) nodes with a single int

C++ Code Create an unordered linked list of (at least 5) nodes with a single integer or double contained in each. Order this linked list by pushing the nodes onto a stack(s). The …

C++ Code Design( Pseudocode and Code) Design a program that allows two players t

C++ Code Design( Pseudocode and Code) Design a program that allows two players to play a game of tic-tac-toe. Use a two-dimensional String array with three rows and three columns …

C++ Code Earthquake Report Modify the bubble-sort function (Attached below) from

C++ Code Earthquake Report Modify the bubble-sort function (Attached below) from last week’s lab exercise to sort the rows of a two dimensional array in descending order of the fi…

C++ Code I need to edit the code in the function deleteDuplicates() to reduce th

C++ Code I need to edit the code in the function deleteDuplicates() to reduce the Big O to O(N), meaning, to get to use only one loop instead of two. The output after the sorting …

C++ Code Implement a recursive descent parser for a logic calculator based on th

C++ Code Implement a recursive descent parser for a logic calculator based on the Grammar below. The user can use either capital or lower case 'T' and 'F' in their expression. Use…

C++ Code Problem A) (20 Points) Implement the Big Three for the CarMakeInventory

C++ Code Problem A) (20 Points) Implement the Big Three for the CarMakeInventory Class and use them In lecture we will discuss the Course class to demonstrate the use of dynamic m…

C++ Code Problem I was doing a lab for school and was doing it a way the teacher

C++ Code Problem I was doing a lab for school and was doing it a way the teacher didn't like it. He changed parts of my code. So now I can't get it to work. Can someone please hel…

C++ Code Using the listType code from Chapter 13 of your text as a guide, create

C++ Code Using the listType code from Chapter 13 of your text as a guide, create a template class bagType which may be filled with any one of the standard data types including, as…

C++ Code Without chaning any code below, could anyone help me to get the second

C++ Code Without chaning any code below, could anyone help me to get the second line? Ex1) Please enter a number from 3 to 100: 6 2, 4 (<--------This is what I need - there sho…

C++ Code must use cin, cout, iostream, cmath for pow(n,x) Here\'s the prompt: Th

C++ Code must use cin, cout, iostream, cmath for pow(n,x) Here's the prompt: The distance a vehicle travels can be calculated as follows: distance = speed * time For example, if a…

C++ Code output of: Q5: What will be the output of this program after an instanc

C++ Code output of: Q5: What will be the output of this program after an instance of Class5 is created? (5 points) #include <iostream> using namespace std; class Class1 { pu…

C++ Code. Define a function called temperature_converte. This program converts a

C++ Code. Define a function called temperature_converte. This program converts a series of temperature readings from Celsius to Fahrenheit or vice-versa, depending on a choice mad…

C++ Code. I messed up some where in the code. I need it tell me how many people

C++ Code. I messed up some where in the code. I need it tell me how many people got the highest grade and also the lowest grade. Example: (# of people with the highest grade- 3) I…

C++ Code. Write several functions to manipulate vectors of doubles or strings: 1

C++ Code. Write several functions to manipulate vectors of doubles or strings: 1. A void function ReadVector that has a single vector parameter vector & inVect. The function s…

C++ Code: -input any number between (0-100) • if the number is odd, the program

C++ Code: -input any number between (0-100) • if the number is odd, the program ends (do nothing) • if the number is even, output all the even numbers to 100 above the input Requi…

C++ Code: Problem B: Quasar game ( This code must be written in C++, Thanks) Sup

C++ Code: Problem B: Quasar game (This code must be written in C++, Thanks) Suppose there is a game with two options: A and B. Each of these options adds a different amount of poi…

C++ Code: This assignment will have you read information in from various files,

C++ Code: This assignment will have you read information in from various files, perform exception handling when reading those files, and create a base class and derived classes wi…

C++ Code: Write a program that opens a file of the users choice that contains a

C++ Code: Write a program that opens a file of the users choice that contains a list of birthdays. Extract from this file two things: (1) the date with the most common birthday (a…

C++ Coding (4-6 Please make code Copy and Paste-able , also this is an intro cla

C++ Coding (4-6 Please make code Copy and Paste-able, also this is an intro class so please nothing too advanced) 1 Jacob Emily 2 Michael Emma 3 Joshua Madison 4 Matthew Olivia 5 …

C++ Coding (4-6 Please make code Copy and Paste-able , also this is an intro cla

C++ Coding (4-6 Please make code Copy and Paste-able, also this is an intro class so please nothing too advanced) 6. Write a function declaration for a function that computes inte…

C++ Coding (4-6 Please make code Copy and Paste-able , also this is an intro cla

C++ Coding (4-6 Please make code Copy and Paste-able, also this is an intro class so please nothing too advanced) 6. Write a function declaration for a function that computes inte…

C++ Coding An object\'s mass can be measured in kilograms. The weight is measure

C++ Coding An object's mass can be measured in kilograms. The weight is measured in newtons. So an object of a specific mass (in kilograms) would have one weight (in newtons) on t…

C++ Coding Create a class called IntegerSet . Each object of class IntegerSet ca

C++ Coding Create a class called IntegerSet.   Each object of class IntegerSet can hold positive integers in the range 0 through 255 and most common set operations are available. …

C++ Coding HW Design your main program so that it has a while loop that will run

C++ Coding HW Design your main program so that it has a while loop that will run until the user chooses to exit. Inside this loop, you will also need to prompt the user to ask the…

C++ Coding HW HELP! I came up with a code but I received feedback from my instru

C++ Coding HW HELP! I came up with a code but I received feedback from my instructor that read: "Program desc should add: allows user to continue until he selects -1. Any choice n…

C++ Coding HW! In this lab, you will be examining a set of temperatures collecte

C++ Coding HW! In this lab, you will be examining a set of temperatures collected over a twenty four hour period. Be sure to make use of an array to store these temperatures. You …

C++ Coding Help Provide two different implementations, an array and a linked lis

C++ Coding Help Provide two different implementations, an array and a linked list, to maintain a list of names (two separate programs). The following operations are available: ins…

C++ Coding Help with part of my graph program. Im just finding a hard time imple

C++ Coding Help with part of my graph program. Im just finding a hard time implementing the program (the .cpp files). Please leave a comment if you need more info Here is what i h…

C++ Coding Help. I have a program but I need it to ask the user for their studen

C++ Coding Help. I have a program but I need it to ask the user for their student ID number, once that is colleted it will look through the sessions.txt file and make sure that th…

C++ Coding Objective To gain experience and practice using classes. Problem As a

C++ Coding Objective To gain experience and practice using classes. Problem As a concierge at a local hotel, you would like to simplify your work when ordering taxi rides for your…

C++ Coding Practice Assignment, not sure how to do this, this opens up the next

C++ Coding Practice Assignment, not sure how to do this, this opens up the next section of my learning, could someone please help!! Please leave notes within the project so I can …

C++ Coding Solve the following problems from the book: Engineering analysis and

C++ Coding Solve the following problems from the book: Engineering analysis and computation Harry H. Cheng, McGraw-Hill, 200 attached a copy of these problems from the book) From …

C++ Coding This program will calculate the gain or loss for stock that you have

C++ Coding This program will calculate the gain or loss for stock that you have purchased and later sold Write a program that reads in the name of a company. Since the company nam…

C++ Coding Your program will make use of long long int variables for all calcula

C++ Coding Your program will make use of long long int variables for all calculations. Note: the use of long long int requires that you have ++11 support. You should have this aut…

C++ Coding question; Write a class called Student that has two data members - a

C++ Coding question; Write a class called Student that has two data members - a string variable called name and a double variable called score. It should have a constructor that t…

C++ Codons.txt (file contents) uuuuucuuauugcuucuccuacugauuaucauaaugguugucguagugu

C++ Codons.txt (file contents) uuuuucuuauugcuucuccuacugauuaucauaaugguugucguagugucuuccucaucgccucccccaccgacuaccacaacggcugccgcagcguauuacuaauagcaucaccaacagaauaacaaauuuuucuuauugcuucucc…

C++ Codons.txt (file contents) uuuuucuuauugcuucuccuacugauuaucauaaugguugucguagugu

C++ Codons.txt (file contents) uuuuucuuauugcuucuccuacugauuaucauaaugguugucguagugucuuccucaucgccucccccaccgacuaccacaacggcugccgcagcguauuacuaauagcaucaccaacagaauaacaaauuuuucuuauugcuucucc…

C++ Codons.txt (file contents) uuuuucuuauugcuucuccuacugauuaucauaaugguugucguagugu

C++ Codons.txt (file contents) uuuuucuuauugcuucuccuacugauuaucauaaugguugucguagugucuuccucaucgccucccccaccgacuaccacaacggcugccgcagcguauuacuaauagcaucaccaacagaauaacaaauuuuucuuauugcuucucc…

C++ Coin Toss Write a program to simulate the output of unbiased coin tosses-equ

C++ Coin Toss Write a program to simulate the output of unbiased coin tosses-equally likely head or tail. Your program should display the result of current toss (i.e. head or tail…

C++ Combination Lock Program Specify, design, and implement a class that can be

C++ Combination Lock Program Specify, design, and implement a class that can be used in a program that simulates a combination lock. The lock has a circular knob, with the numbers…