plz help me answer questions Medgar Evers College Problem Set Trof Small 1D The

Question

plz help me answer questions

Medgar Evers College Problem Set Trof Small 1D The following soquence of DNA is transenhed and encoudks a small motein wll Met Tyr Arg Gly Ala protein with the i serquence a) Which strand of DNA is the template strand tor strand for transeripticer direction (right to left or beft to right) does RNA polymerase move along the temglate as Which direction [right to left or lett to n it transcribes this gene? b) What is the sequence of Indicate the S' and3' directions of this gene e) A single base mutation in the gone results in synthesis of the peptide Met Tyr. What is the soquence of oucleotides making up the mRNA produced by this mutant gener 2) List three characteristics of the yenelic code S) How can you distinguish experimentally among DNA polymarave I. RNA polymerase, id primase? 4) Suppose you isolate a mutant bacterium that does not have an active ligase bacterium replicate? Why or why not? At what step will replication be halted enzyme. Can this

Explanation / Answer

5' CCTATGCCCGCATCATTACGCACCTCTGTACATGGC 3'

3' GGATACGGGCGTAGTAATGCGTGGAGACATGTACCC 5'

1)

a) The strand of DNA which act as a template strand is 3'-5' from right to left.

b) RNA sequence 5' AUGUACAGAGGUGCG 3'

c) A single base mutation which results in the production of Met Tyr. The sequence in that mRNA is 5' AUGUACUGA 3'

2) Three Characteristics of genetic code are:

i) Genetic code is 'Universal' - same in all organisms

ii) Genetic code has 'No punctuations' - no gaps between a codon

iii) Always mRNA synthesis takes place in 5' - 3' direction only

3) DNA Polymerase III - performs polymerisation in 5' - 3' direction

RNA Polymerase - produces primary transcript RNA

Primase - enzyme involved in replication of DNA

4) If a mutant bacterium does not have an active ligase enzyme, the process of 'ligation' is disturbed. So the process of replication is disturbed.

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.