Following is the DNA template strand of a small prokaryotic gene to be transcrib
ID: 91752 • Letter: F
Question
Following is the DNA template strand of a small prokaryotic gene to be transcribed (assume this is the entire gene). Numbers above the sequence are for questions C, D, & E): Answer what you can, thanks!
3' TTCTACAGAGTTATATCCACTGAG 5'
A. Write out the nucleotide sequence of the mRNA that will be produced by transcription of this gene.
B. Write out the amino acid sequence of the polypeptide produced by translation of this mRNA.
C. If the "A" nucleotide underneath the number 1 was mutated and changed to a "C" nucleotide, indicate what kind of mutation this would be. Explain your answer.
D. If the "C" nucleotide underneath number 2 was mutated and changed to a "T" nucleotide, indicate what kind of mutation this would be. Explain your answer.
E. If the "T" nucleotide underneath number 3 was mutated and changed to a "G" nucleotide, indicate what kind of mutation this would be. Explain
Thanks!
Explanation / Answer
Well if we transcribe the sequence given i.e.
3'TTCTACAGATTATATCCACTGAG5'
The resulting mRNA would be
5'AAGAUGUCUCAAUAUAGGUGACUC5'
After translation the polypeptide sequence would be
5'UTRMetSerGlnTyrArgSTOPUTR3'
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.