Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The following DNA sequence represents a eukaryotic gene. Indicate which is the t

ID: 88020 • Letter: T

Question

The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), and write out the nucleotide sequence of the initial transcript. You need to process the initial transcript to make an mRNA (there is an intron in the gene: using the information about splicing on pp. 306-307 of your textbook, locate and remove the intron) and write out the sequence of the completely processed mRNA. Finally, translate the mRNA and write out the amino acid sequence of the encoded polypeptide. 5'- ACCGGCCTCTCTCTCACACACAGTACGGCGTTTATTGGGACTTCAAATCATAT GGCCATTACAAGCCCTGCAGAAAGGGAAGGCGAAGCTCAGGATAAGTA... 3'- TGGCCGGAGAGAGAGTGTGTGTCATGCCGCAAATAACCCTGAAGTTTAGTATA CCGGTAATGTTCGGGACGTCTTTCCCTTCCGCTTCGAGTCCTATTCAT... ..CAGGTGACACTCTACTCACCGGATAAGTATTGTCATCTCCCAAGGGGGTG AATATCCGCGCATCCGCTTTATATCGCCTGATTAACGCAGTCCTACACAAT- 3' ..GTCCACTGTGAGATGAGTGGCCTATTCATAACAGTAGAGGGTTCCCCCAC TTATAGGCGCGTAGGCGAAATATAGCGGACTAATTGCGTCAGGATGTGTTA-5'

Explanation / Answer

The template strand and coding strand are very confusing terms, which are often misquoted.

The template strand in the one to which RNA polymerase binds. The new RNA strand extends in 5’ to 3’ direction. So the template strand should be 3’ to 5’ strand of DNA. This template is complementary to the RNA sequence and is antiparallel.

The coding strand does not participate in the transcription. This strand is antiparallel to the template strand hence it runs in 5’ to 3’ direction. This strand has the same sequence as RNA transcript except that T is replaced by U.

In the example, the strand which runs in 5’ to 3’ direction is Coding strand.

The strand in 3’ to 5’direction is Template strand.

The initiation of transcript occurs at the first methionine codon on template strand (3’ to 5’). The methionine codon is AUG, that is the template stand should have the complementary sequence to this. So the transcription begins from the TAG on the template strand.

The initial transcript sequence goes like this (Remember, it is same as coding strand but, T is replaced with U)

5‘AUCAUAU…..GUGUUA 3’

The other question needs additional information as discussed in page no. 306 in the question. I cannot solve the question without that information. But I will give you the outline on how to solve.

In the given page, find the out the intron start site and end site. Remove that sequence from the RNA transcript. It becomes a mature RNA. Now using expascy tool, determine the amino acid sequence.                

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote