BIOL41: Microbiology STUDY GUIDE week 5 Microbial Genetics 1. A. Define the foll

ID: 83265 • Letter: B

Question

BIOL41: Microbiology STUDY GUIDE week 5 Microbial Genetics 1. A. Define the following terms: Genetics, genome, chromosome, plasmid, and gene. B. What is the difference between the genotype and the phenotype? 2. A. What are the three subunits of a nucleotide? B. What is the monomer unit of DNA and what are its three parts? C What is the shape of a DNA molecule? What makes up the sides of the "ladder"? What makes up the steps of the "ladder"? What type of bond links the "steps"? D. Describe why the strands of DNA are antiparallel E. where in a prokaryotic cell is DNA found? How about a eukaryotic cell? I. Draw a short section of DNA with six bases on each side. (Use each possible base at least once 3. A. What is the overall purpose of DNA replication? B. List and explain the basic steps in DNA replication. Be sure to include the enzymes that participate a each stage (4 in lecture, your book mentions 5). Draw the following three basic stages of DNA replication using a strand of DNA that is 6 base pairs long, using each base at least once (you just use the letters to represent the bases, you do not need to draw the structure of the entire nucleotide!): 1. The original molecule 2. Molecule half split with a few new nucleotides added to show the start of replicatio 3 The two new molecules of DNA. (Indicate which two strands are from the original strand) Describe why (what enzyme) DNA is synthesized only in the 5' 3' direction D. Why is DNA replication said to be semiconservative? E. Describe why it is essential that the new DNA strand is proofread as it is being made. 4. A. What does the term gene expression mean? B.What are the two major steps involved in gene expression? C. Must DNA replication occur in order foran individualcell to make proteins? 5. A. What are the three different types of RNA studied? B. Draw a short section of RNA with six bases. (Use each possible base at least once) 6. A. Name three physical differences between DNA and RNA. B. What is the function of DNA? C. What is the function of RNA? D. Why is it critical that proofreading occur during DNA replication, but that proofreading is absent during transcription and translation? 7. A. In your own words, give a simplified definition as to what happens in transcription. B. Now, briefly outline the step of transcription. Draw three basic stages of transcription using your piece of DNA from Question R2:1. Original DNA molecule 2. Molecule half split with a few new RNA des added to show the start of transcription 3 original strand of DNA and new strand of mRNA. C. Where does RNA polymerase bind to the DNA to begin transcription? Where does it terminate tra nscription? Which direction does it move along the DNA strand? 8. A. What is the overall purpose of mRNA made in the process of transcription? B. Where does transcription occur in rokaryotes? In eukaryotes? Where does the mRNA molecule move after transcription is complete? D. In your own words, what is a codon? E. Using your strand of mRNA transcribed above, what are the two codons and what amino acids do they represent? 9. A. Briefly explain how the "code" for a particular protein found in the DN is ultimately expressed by the production of that same protein in the cytoplasm. (Brief overview of the genetic code) You can use drawings to help explain. B your own words, give a simplified definition as to what happens in translation. Now,brieflyoutline the steps of translation include at least the terms: mRNA,codon, ribosome, tRNA, amino acid, polypeptide, RNA polymerase 10. A. With what type of bond are the amino acids joined together to form apolypeptide 9PROTEIN)? B. Once a polypeptide chain is formed (primary structure) how does it become a functional protein? C. Why is the translation/coiling/folding of the amino acid/polypeptide chain so important? What if it's not translated exactly as intended? What if it is not folded "exactly" as intended? 11. Using the given DNA sequence of the template strand, answer the following questions.A. What are the mRNA codons? B. What are the tRNA anticodons? C. What is the sequence of the amino acids after translation and transcription? DNA: TACAATGTACAATAAACGTCGCATTCGGTAC 12. A. What is gene regulation? Why does gene expression (transcription and translation) need to be regulated? B. What is an operon? C What is an inducible operon? Name an example and explain why the genes that are coding for the

Explanation / Answer

1.
Genetics: The study of heredity is called Genetics. Heredity can be deifined as "inheritance of a trait from parents to their offspring".

Genome: Hapliod set of chromosomes of an organism is called as genome.

Chromosome:Chroma - colour; Soma - body.

Tightly coined DNA with histone proteins are called as chromosomes. It appears long, stringy aggregate of genes that carries heredity information from one generation to next.

Plasmid: A small circular DNA/genetic structure in the cytoplasm which is independent from main chromosomes.

Gene: A unit of heridity or a hertiable nucleotide sequence of a chromosome.

Difference b/n genotype and phenotype

Character

Genotype

Phenotype

Definition

Genetic makeup of an organism

Detectable expression of genotype

Inheritance

Heritable character

Non heritable

Can be determined by

By crossing, by molecular techniques

By observation

ACCRODING TO CHEGG GUIDELINES WE HAVE TO ANSWER ONE QEUSTION AT A TIME. POST THE REST AS SEPERATE QEUSTIONS THEN I CAN HELP YOU.