13. Which of the following sequences contain a six-nucleotide inverted repeat? A

ID: 80818 • Letter: 1

Question

13. Which of the following sequences contain a six-nucleotide inverted repeat?

A. GTCACGCGACGATACGGTCACG

B. GTCACGACTAGCCTAGTCGCTG

C. GTCACGACTAGCCATCAGCCTG

D. GTCACGACTAGCCCGACTAGTG

14. Which of the following is not a mechanism for regulating gene expression before the mature RNA transcript is produced?

A. mRNA splicing

B. protein degradation

C. attenuation of transcription elongation

D. modification of mRNA termini

15. Which of the following is not true of the regulation of translation initiation in eukaryotes?

A. Repressors bind to the 3' untranslated region of mRNA.

B. Repressors bind to initiation factors.

C. Repressors bind to translational start sites of mRNA.

D. Repressors bind to translational release factors.

16. The 5' upstream regions of transcriptionally active genes generally do not exhibit which of the following characteristics?

A. contain binding sites for known regulatory proteins

B. relatively fewer nucleosomes

C. increased in vitro sensitivity to DNase I

D. increased concentration of histone H1

13. The sequences contain a six-nucleotide inverted repeat is

GTCACGACTAGCCTAGTCGCTG

14. protein degradation is not a mechanism for regulating gene expression before the mature RNA transcript is produced

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.