Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

For the following problem refer to the DNA molecule below and remember to indica

ID: 80543 • Letter: F

Question

For the following problem refer to the DNA molecule below and remember to indicate the 5' end of each oligonucleotide.

5' GCATGTACGTCCTTGAATCGTAGGGCTAGGGGAAGTCCAAAAAAATTTC 3'

3' CGTACATGCAGGAACTTAGCATCCCGATCCCCTTCAGGTTTTTTTAAAG 5'

1) Give the sequence of oligonucleotides each 12 bases in length required to amplify the given DNA molecule.

2) Using the above designed primers you attempt to amplify the DNA sequence but to your surprise no amplified product is detected. Please provide a rationale as to why.

Explanation / Answer

(1) Forward primer : 5'-GCATGTACGTCC-3' (exact complement to the template DNA)
      Reverse primer : 3'-AGGGGAAGTCCA-5'


(2) The primer length has to be increases for obtaining better amplification of the DNA. The optimum primer length would be 18-21 nucleotides. The G:C ratio also has to be considered for good amplification.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote