Given the sequence below from a patient with metastatic melanoma: Identify the g

Question

Given the sequence below from a patient with metastatic melanoma:

Identify the gene and exon sequenced and if it is wild type or mutant. If mutant is there any clinical significance to the mutation –why or why not?

#5 forward sequence:

CTTACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACARAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTKTCTGGATCCATTTTGTGGATGGTAAGAATTGAGGCTATTTTTCCACTGATTAAATTTTTGGCCCTGAGATGCTGCGTCATAGCTGTTTC

#6 reverse sequence:

AGCCTCAATTCTTACCATCCACAAAATGGATCCAGACAACTGTTCAAACTGATGGSACCCACTCCATCGAGATTTCWYTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGAAATATATCTGAGGTGTAGTAAGTAAAGGAAAACAGTAGATCTCATTTTCCTATCAGAGCAAGCACTGGCCGTCGTTTTACA

Explanation / Answer

The gene sequence was searched in NCBI BLAST alignment window and identified to be B-Raf proto-oncogene, (BRAF) is in exon 15 region which encodes a serine/threonine kinase protein belonging to the raf/mil family of serine/threonine protein kinases. This is regulatory enzyme of the MAP kinase/ERKs signaling pathway involved in cell division, cell differentiation, and secretion.

The present sequence was found mutations from wildtype and the mutation from GT to RA in position 176428-29 in this gene are associated with severe menifestations like cardiofaciocutaneous syndrome which forms heart defects, mental retardation and this can be marked from stinctive facial appearance like mongoloid. This gene have also been marked as protooncogene as mutations have found to be associated with various cancers, including non-Hodgkin lymphoma, malignant melanoma, malignant melanoma, adenocarcinoma of lung, thyroid carcinoma,non-small cell lung carcinoma, and colorectal cancer.

Related Questions

Navigate

• Browse (All)
• Browse G
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.