33. What is the purpose of the peptidyl transferase function in ribosomes? a. it
ID: 68377 • Letter: 3
Question
33. What is the purpose of the peptidyl transferase function in ribosomes? a. it charges tRNA:s b. it acetylates the end of a protein after translation c. it cleaves the polypeptide from the last tRNA during termination d. it moves ribosomes along mRNA during translatiorn e. it forms peptide bonds 34. Glutamine is coded for by just two codons, CAA and CAG. The best explanation as to how this degeneracy occurs is: a. two different tRNAs must be used b. wobble in the 5'position of the anticodon allows a single tRNA to bind to both codons c. wobble in the 3'position of the anticodon allows a single tRNA to bind to both codons d. glutamine is carried by more than one tRNA e. an organism will use one codon or the other, but not both For questions 35-40 use the following RNA-like (coding) strand sequence information -35 -10 AGCTTGACATGCGGTGTACCGTCATTATAATCGCCATGTCACCCGGTTGTGCAAGAGGG 4 ACTGACGATGCCGCTGGACGCCTGTTATATTGAGATCGCTGATCGATTGACTAGGC GGCTGGATGCCCTCTCGATCTGATGCTTAGCAGGATGTACCGTCGTTTTTTCGA 3' 35. This represents a gene of a a. eukaryote b. prokaryote c. archeae d. it is impossible to tell with the sequence given e. none of the above 36. The start of translation codon is identified in region b. 2 d. 4 37. The consensus sequence in region codes for the binding of the ribosome in the mRNA b. 2 d. 4 Page 8 of 20Explanation / Answer
33. e. It forms the peptide bonds.
During elongation, amino acids are added to the growing polypeptide chain according to the mRNA sequence. The aminoacyl tRNA molecules are picked up by the elongation factors in the presence of GTP, Which enters the A site. On the ribosome, the mRNA codon bound at the A-site will be matched with appropriate anticodon of aminoacyl tRNA. The translational machinery plays a key role in this selection and proof reading.
After binding of correct codon and anti codon, the new amino acid is linked to the growing polypeptide chain in the P –site (peptidyl site) by a peptide bond. This process is catalysed by an enzyme peptidyltransferase located at the peptidyl transferase center of the large ribosomal subunit. A new peptidyl-tRNA now occupies the A site. The empty tRNA now moves to the E site and this process is facilitated by another elongation factor (eEF 2) and GTP. The new peptidyl tRNA moves to the P site, and the cycle repeats until it reads a stop codon. The following picture depicts the various stages in elongation.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.