Of which part of the mRN A below is the sequence 5\'-UAUUCCGG-3? \"5 CCCGAUACUAU

Question

Of which part of the mRN A below is the sequence 5'-UAUUCCGG-3? "5 CCCGAUACUAUUCCGGCCGAUGCUCAGACUUUAGAACCUCUUCUCUGGGCGGC-3' The protein coding segment The 5' UTR The 3' UTR The poly A addition site The sequence 5'-UAUUCCGG-3' is not in the mRNA shown You have an E. coli methionine biosynthetic mutant (the methionine biosynthetic pathway is shown above with the relevant enzymes). The mutant cannot grow on minimal medium but can grow in the presence of either methionine or homocysteine, but none of the other compounds shown. In which gene is the mutation most likely? met2 met B met C met E a and b

Explanation / Answer

9. (b) The 5' UTR.

5' UTR is the untranslated region of mRNA that is present upstream to the start codon (AUG). The given sequence 5' UAUUCCGG 3' is present ipstream to the start codon.

Thus, the correst option is (b) The 5' UTR.

Related Questions

Navigate

• Browse (All)
• Browse O
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.