let’s say you collaborate with another lab that is studying the ability of a spe
ID: 65675 • Letter: L
Question
let’s say you collaborate with another lab that is studying the ability of a specific protein kinase, PKC, to phosphorylate Gz. (There has been a paper published in this area, years ago, which puts forth a hypothesis of the specific amino acid in Gz that is phosphorylated by PKC. See this paper: http://www.jbc.org/content/270/39/23119.full.pdf+html ) You give your three Gz cDNA clones to your collaborator, and in her lab she determines that one of your three clones encodes a protein that fails to be phosphorylated by PKC, whereas your other two Gz clones encode proteins that are phosphorylated in her experiment. Indicate which clone A, B, or C is most likely the one that fails to be phosphorylated by PKC, explain your reasoning, and also explain how your results change the hypothesis described in the paper by Fields and Casey regarding the specific site of phosphorylation on Gz.
clone A. 5’- cgctgctgccagaccatgggatgtcggcaagcctcagag [hundreds more bases] -3’
clone B. 5’- cgctgctgccagaccatgggaggtcggcaaagctcagag [hundreds more bases] -3’
clone C. 5’- cgctgctgccagaccatgggatgtcggcaaagctcagag [hundreds more bases] -3’
I submitted this question 2 days ago, and this is the answer I got back:
The sequences provided all of the three donot show any phosphorylation site as computed by software.
That answer can't be correct.
Explanation / Answer
CLONE A would be the best sequence for a mutant since two differences can be seen. It has two mutations while the other two sequences have one mutation.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.