7) The hnRNA sequence of a novel gene encoding for a growth factor s given below

Question

7) The hnRNA sequence of a novel gene encoding for a growth factor s given below. It is comprised of 2 exons and 1 intron. In the initial characterization of this gene, you want to: Augcgcaccccga u cgagu ugcaagga ccu u a ucu ugagcagcccgagcga ugguggggcgacu u u uggcga a cggca uuucggcgaaacgggauauuuuuucccucacagggcaugccaacguggggacaugcauauuaaaaagaagaaauaa a) Write the sequence of the mature mRNA. b) Write the predicted amino acid sequence from this mRNA. c) Would this protein interact with an integrin receptor? Why or why not?

Explanation / Answer

In eukaryotes, RNA formed before splicing is known as heteronuclear RNA (hnRNA). hn RNA contains introns: that donot code for proteins and exons: that code for a protein. Splicing process removes interveining sequences called introns and ligate exons forming mature mRNA.

Related Questions

Navigate

• Browse (All)
• Browse 7
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.