Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

victoria made a chicken sandwich and left it on the counter. when victoria retur

ID: 61583 • Letter: V

Question

victoria made a chicken sandwich and left it on the counter. when victoria returned, she saw that someone had taken a bite out of the sandwich. suspecting that Elsa was responsible, victoria isolated DNA from the bite area for PCR analysis. if the sequence of human locus 107A varied between victoria and Elsa as shown below, describe how you could distinguish between them (there are several ways). As a hint, some interesting regions are in bold

Victoria

5' AGTTTGCGATCGATCCGGACACCACCACCACCACTAGCGAGCCATAGTGGCAGTGCGCAAAAGTATCGG-3'

Elsa

5' AGTTTGCGATCGATAGGGACACCACCACTAGAATTCGCGAGCCATAGTGGCAGTGCGCAAAAGTATCGG-3'

Explanation / Answer

RFLP or AFLP of both the person is diffeernt and which acts is important marker for both the individual. so by comparing RFLP of Victorai, Elsa and sample from bite site we enable to draw conclusion.