Please answer ALL PARTS of this question (A-B)! Thank you! Let\'s say you plan t

Question

Please answer ALL PARTS of this question (A-B)! Thank you!

Let's say you plan to sequence the following DNA fragment (cut the sequence out and paste into your homework). Your sequencing reaction includes the primer: CCGCCGGGCCCCAT and the following fluorescent dideoxynucleotides: red ddGTP, green ddATP and blue TP.CGCGATGTTTTTCAGCTTAGAAAAAGGATGACTAGCTAGCTACCTAGATGGGGCCCGGCGGATT Place a box around the sequence where this primer will hybridize. List the fragment sizes in the sequencing reaction that will be RED.

Explanation / Answer

Tautomeric shift:

The spontaneous isomerization of a nitrogen base to an alternative hydrogen-bonding form, possibly resulting in a mutation. Reversible shifts of proton position in a molecule. Bases in nucleic acids shift between keto and enol forms or between amino and imino forms.

Deamination:

Deamination is the removal of an amine group from a molecule. Enzymes that catalyse this reaction are called deaminases.

In both the mutations above, there is no loss of any base just there is change in the base composition.

But in the mutation due to base loss, the nucleotide base itself is replaced by the other one.

CGCGATGTTTTTCAGCTTAGAAAAAGCATGACTAGCTAGCTAGCTACCTAGATGGGGCCCGGCGGATT

a. The primer will to the sequence above is underlined

b. The fragment size would be 15 nucleotides

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.