MULTIPLE CHOICE: 1. The promoter for a gene is generally found _____________ wit

ID: 59629 • Letter: M

Question

MULTIPLE CHOICE:

1. The promoter for a gene is generally found _____________ with respect to the gene itself.

a. downstream

b. upstream

c. either downstrea or upstream

d. within the gene

2. What might you expect if a mutation deleted (removed) the promoter sequence from its corresponding gene?

a. no change in transcription

b. no transcription of gene

c. an increase in transcription of the gene

d. no change in transcription but a decrease in translation of the message

3. A sigma factor is a protein that binds to __________ and to ___________ during _________________.

a. DNA polymerase, RNA polymerase, replication

b. RNA, DNA polymerase, transcription

c. ribosomes, rRNA, translation

d. DNA, RNA polymerase, transcription

4. Given the following mRNA sequence and knowing the codon 1 is the AUG (start codon), which would be codon 4 in this message?

5' GCUACUGCUAGUCAUGCUAUCGUUACGUCUGUCUAU 3'

a.CUA

b.UAU

c. AUC

d. UCG

e. UUA

1. (b) upstream

2. (b) no transcription of gene

3. (d) DNA, RNA polymerase, transcription (sigma factors are needed only for initiation of RNA synthesis)

4. (e) UUA

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.