1) A tRNA with the anticodon 3’-ACC-5’ would carry the amino acid: a. serine. b.

Question

1) A tRNA with the anticodon 3’-ACC-5’ would carry the amino acid:

a. serine.

b. phenylalanine.

c. tryptophan.

d. threonine.

e. tyrosine.

2. In bacteria, the Shine-Dalgarno sequence is found on the mRNA and is recognized by the ________________________ to reveal __________________________.

a. the 30S subunit; the translation START codon

b. ribosome A site; the translation START codon

c. amber tRNA; the translation STOP codon

d. initiator tRNA; the translation START codon

e. the 16S rRNA; the translation STOP codon

3. You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein.

5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3'

Below, provide the sequence of amino acids that would result from the translation of an mRNA from the longest ORF (remember, there are 6 reading frames), indicating the amino (N) and carboxy (C) termini.

Explanation / Answer

Q1).

c. tryptophan.

Q2)

a. the 30S subunit; the translation START codon

An initiation site on bacterial mRNA consists of the AUG initiation codon preceded with a gap of ~10 bases by the Shine-Dalgarno polypurine hexamer. The rRNA of the 30S bacterial ribosomal subunit has a complementary sequence that base pairs with the Shine-Dalgarno sequence during initiation.

Q3).

First write the complementary strand of DNA. Then look for the longest possible ORF in both strands, reading each in a 5´ to 3´ direction. In this instance the longest open reading frame is in the reverse orientation (strand 2). Strand 2 will be the sense strand and Strand 1 the antisense strand

Strand 1     5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT  3'

Strand 2     3´  AGTTACATTGCGCGATGGGCCTCGAGACCCGGGTTTAAAGTAGGTGA   5´

1         S M * R A T R S S G P K F H P                          

2          Q C N A L P G A L G P N F I H                         

3           N V T R Y P E L W A Q I S S T                        

4           *  H L A S G P A R P G F K M W                        

5          E I Y R A V R L E P G L N * G                         

6         K L T V R * G S S Q A W I E D

mRNA    5´ AGU-GGA-UGA-AAU-UUG-GGC-CCA-GAG-CUC-CGG-GUA-GCG-CGU-UAC-AUU-GA 3´

Protein    N- Ser-Gly-STOP-Asn-Leu-Gly-Pro –Glu-Leu-Arg-Val-Ala-ArgTry-Ile-C

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.