1. The sequence of a gene is 5\'-AGTGGATCCGT. What RNA sequence could lead to a

ID: 51851 • Letter: 1

Question

1. The sequence of a gene is 5'-AGTGGATCCGT. What RNA sequence could lead to a loss of the protein product in a eukaryotic cell through RNAi?

2. A human skin cell expresses genes 2 and 3 but not 1 and 4. Which of the following is NOT consistent with this observation?

3. When nucleotides are added to a growing nucleic acid chain:

3’- TAGTCTACAGGGTAAATCATG -5’

5’- ATCAGATGTCCCATTTAGTAC -3’

If a promoter is located on the LEFT hand side of this small gene region, what will be the final product of transcription in a eukaryotic cell?

5. Proteins perform many roles in cells. List them

A scientist obtained the following results from analysis of a normal cell and a cancer cell.

What occur during the initiation of transcription?

3. When nucleotides are added to a growing nucleic acid chain,

a. formation of phosphodiester bond between phosphate groups take place.

b. The process is take place by hydrolysis of a high-energy phosphate bond with release of the two distal phosphates as a pyrophosphate.

5. Functions of Protein:

a. They act as a source of energy.

b. They help in the repair and maintenance of the body.

c. They form hormones which play an important role in the control and coordination of our body.

d. they are a part of enzymes which act as biocatalyast.

e. They form antibodies which help prevent infection and disease in our body.

7. Transcription take place in 3 steps: initiation, Elongation and termination.

Initiation: following occur during initiation

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.