Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

If this mRNA is translated beginning with the first AUG codon in its sequence, w

ID: 517797 • Letter: I

Question

If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?

This question has multiple parts. Work all the parts to get the most points. The 5-end of an mRNA has the sequence: CGAUUGCAGGACCCUUUACGAUGGACAGGCUGACCGGGCUA..., What is the nucleotide sequence of the DNA template strand from which it was transcribed? 5'- TAGCCCG GTCAGCCTGTCCATCGTAAAGGGTCCTGCAATCG Correct The template DNA strand from which this mRNA is transcribed will have the complementary base sequence, with thymine bases in place of uracil bases. The 5'-end of the template DNA will correspond to the 3-end of the mRNA. Therefore, the DNA nucleotide sequence, written from the 5 to 3-end, is as follows: TAGCCCGGTCA GCCTGTCCATCGTAA AGGGTCCTGCAATCG If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC Histidine GAC Aspartate UAC Tyrosine AAG Lysine CAG Glutamine GAG Glutamate UAG stop AAU Asparagine CAU Histidine GAU Aspartate UAU Tyrosine ACA Threonine CCA Proline GCA Alanine UCA Serine ACC Threonine CCC Proline GCC Alanine UCC Serine ACG Threonine CCG Proline GCG Alanine UCG Serine ACU Threonine CCU Proline GCU Alanine UCU Serine AGA Arginine CGA Arginine GGA Glycine UGA stop Previous Next

Explanation / Answer

Protein is made by reading mRNA in the 5' to 3' direction and making new protein from its amino end (N-terminus) towards its carboxyl end (C-terminus)

So the given mRNA is

'5 -CGAUUGCAGGACCCUUUACGAUGGACAGGCUGACCGGGCUA - 3'

mRNA is translated beginning with the first AUG codon in the sequence.

'5 -CGAUUGCAGGACCCUUUACGAUG-GAC-AGG-CUG-ACC-GGG-CUA - 3'

AUG-Methionine-Met

GAC-Aspartate-Asp

AGG-Arginine-Arg

CUG-Leucine-Leu

ACC-Threonine-Thr

GGG-Glycine-Gly

CUA-Leucine-Leu

N-Terminal-Met-Asp-Arg-Leu-Thr-Gly-Leu-C-Terminal

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote