Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Report all segments of identity by descent longer than 20 polymorphisms between

ID: 3890576 • Letter: R

Question

Report all segments of identity by descent longer than 20 polymorphisms between pairs of individuals in the following cohort of 15 individuals across 49 polymorphisms:

1 gtctctcggtaggcctcttggcagctctatcggcgagtatctcggcacg

2 gtctcgtgacaggtatctcggtaactatctcggtagctaacgcggcgtg

3 gtcactcggtaggcctctcggtgagtatctcgataggtaactcggcgtc

4 atctcgcggtagccaacttggtaggtctatcggcaagtctctccgcgcc

5 gtctctcggcaggtatattcataggtctattgataggtcacttggcatg

6 gtcacgccgtaggtaacttcgtaggtctatcggtaggtctcgtgacatg

7 gcctatcggtgaccaactcgatgggtctatcggcaagccacgcgatgtg

8 gtctcttcgtagctatcttcataggtcacgcgatgggtcacgcggtgtc

9 gtatctcggtaggcatctcggtagctctatccgtaagtatctcgatgtc

10 atatcttggcaaccaactcgatgggtctatcggcaagccacgcgatatg

11 gtctctcggtaagtatctccgcgagtcaatcgacgggtctatcgacatc

12 atctctcggtaggcctctcggtgagtatctcgataggtctatcggtatg

13 gtcacgcgatagctctctcggtgactctcttggcaggtctatccacgtc

14 gcctctcggtaggcctctcggcaggtcaattggtgggtctctcgatatc

15 gtctcgcgataggtatctcgatgggtctcttgatgggtctctccgcatg

For example if the sequence is "bcd", which occurs in "abcdef" , the starting point would be 2 (b), and the finishing point would be 4(d).

Individuals 7,10 between positions________________________and______________________________

For example if the sequence is "bcd", which occurs in "abcdef" , the starting point would be 2 (b), and the finishing point would be 4(d).

Individuals 3,12 between positions______________________and_________________________________

Explanation / Answer

For the Individuals 7,10. They are between:

1) 7(c) and 10(t)

2) 7(t) and 10(c)

3) 7(c) and 10(t)

4) 7(c) and 10(t)

5)  7(c) and 10(c)

6)  7(c) and 10(t)

7)  7(c) and 10(t)

8)  7(t) and 10(t)

9)  7(c) and 10(t)

10)  7(t) and 10(c)

11)  7(c) and 10(t)

12)  7(c) and 10(t)

13)  7(c) and 10(t)

14)  7(c) and 10(t)

15)  7(c) and 10(t)

For Individuals 3,12between

1) 3(c) and 12(g)

2) 3(c) and 12(g)

3) 3(c) and 12(g)

4) 3(c) and 12(g)

5) 3(c) and 12(g)

6) 3(c) and 12(g)

7) 3(c) and 12(a)

8) 3(c) and 12(g)

9) 3(a) and 12(g)

10) 3(a) and 12(a)

11) 3(c) and 12(a)

12) 3(c) and 12(g)

13) 3(c) and 12(g)

14) 3(c) and 12(g)

15) 3(c) and 12(g)

Thank you. If any queries, ask in comment section.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote