5) You engineer a number of genetic mutations in E. coli?s DNA and want to deter

Question

5) You engineer a number of genetic mutations in E. coli?s DNA and want to determine whether there is any change in size (mRNA length) or relative abundance of the tryptophanase operon mRNA produced by mutant strains. To do so, you will purify total mRNA from unmutated and mutated E. coli strains, run and separate the mRNAs on an agarose gel, and then perform a technique called _______________________ with a labeled nucleic acid probe to specifically visualize the tryptophanase mRNA. 6) You find that E. coli mutants (deletions) in the inverted repeat sequence (see question 4) produce abnormally large tryptophanase mRNA. In a separate experiment, you find that E. coil mutants deleted for the gene encoding the Rho protein produce trypophanase mRNA of normal length. What best describes the function of the inverted repeat structure? a) Functions as an intrinsic terminator b) Functions as binding site for a sigma factor c) Functions as a binding site for the small subunit of ribosomes d) Functions as a pause site for RNA polymerase during Rho-dependent termination e) Functions as a binding site for restriction-modification enzymes 7-8) You sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor (sigma^70). -40 AGAATAGACAAAAACTCTGAGTGTAATAATGTAGCCTCGTAGATCG + 6

Explanation / Answer

Ans.

5. In situ Hybridization.

6. d. Functions as Pause site for RNA Polymerase during Rho-dependent Termination.

7-8. Sigma 70 Factor recognizes base - 10 and - 35.
So, -10 = G and -35 = A

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.