Suppose this is a double-stranded DNA sequence: GGAGATCATTTACCGGTTACCGTA CCTCTAG

Question

Suppose this is a double-stranded DNA sequence:

GGAGATCATTTACCGGTTACCGTA

CCTCTAGTAAATGGCCAATGGCAT

If the sequence is copied, and the newly synthesized material is shown with lower case letters g, a, t, and c, then which of these best describes the structure of the two daughter molecules?

GGAGATcatttaccGGTTACCGTA   and   ggagatCATTTACCggttaccgta

cctctagtaaatggccaatggcat   CCTCTAGTAAATGGCCAATGGCAT

ggagatcatttaccggttaccgta   and   ggagatcatttaccggttaccgta

CCTCTAGTAAATGGCCAATGGCAT   CCTCTAGTAAATGGCCAATGGCAT

ggagatcatttaccggttaccgta   and   GGAGATCATTTACCGGTTACCGTA

cctctagtaaatggccaatggcat   CCTCTAGTAAATGGCCAATGGCAT

GGAGATCATTTACCGGTTACCGTA   and   ggagatcatttaccggttaccgta

cctctagtaaatggccaatggcat   CCTCTAGTAAATGGCCAATGGCAT

GGAGATcatttaccGGTTACCGTA   and   ggagatCATTTACCggttaccgta

cctctagtaaatggccaatggcat   CCTCTAGTAAATGGCCAATGGCAT

Explanation / Answer

The answer is: (last option)

GGAGATCATTTACCGGTTACCGTA   and   ggagatcatttaccggttaccgta

cctctagtaaatggccaatggcat   CCTCTAGTAAATGGCCAATGGCAT

Since the nature of replication is semi-conservative type, the new daughter molecules will have one parental strand (all big letters using A, G, C, and T) and one newly synthesized daughter strand (all small letters using a, g, c, and t).

Related Questions

Navigate

• Browse (All)
• Browse S
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.