1. Given the double-stranded stretch of DNA below, determine the base sequence o
ID: 3509480 • Letter: 1
Question
1. Given the double-stranded stretch of DNA below, determine the base sequence of messenger RNA strand produced using this gene as the template. *Hint: Only one of the two strands is used as the template. 5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA3' 3'TACGGTAACGAATTCGCCCGTAATATAGGTACT5' 2. How many amino acids will this protein contain before and after methionine is cleaved from the strand? Identify the stop codon in this sequence. UAA 4. Using a codon dictionary, determine amino acid sequence of the resulting protein. 5. What would happen if there was a DNA mutation in codon five, in which the first adenine codon in aneusep 6. Why do we make proteins? Using your text and online resources, list 4 important nucleotide is replaced with uracil? Were would e functions of proteins in the human body. 7. Google search "sickle cell anemia." Describe the disease and explain what causes it.Explanation / Answer
1. A=T/U; G=C: 5' A U G C C A U U G C U U A A G C G G G C A U U A U A U C C A U G A 3'
2. Set of 3 Nucleotides is called Codon. Each codon encodes one Amino Acid. The above mRNA contain a total of 33 Nucleotides. So 11 Codons. It encodes 11 amino acids protein. If Methionine removed, the protein contain 10 Amino acids
3. 5' A U G C C A U U G C U U A A G C G G G C A U U A U A U C C A U G A 3': U A A = Ochree; U G A = Opel
4. N----MET-PRO-LEU-LEU-LYS-ARG-ALA-LEU-TYR-PRO-----C
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.