You are asked to create a vector that will express the protein called DCoH in ba
ID: 323114 • Letter: Y
Question
You are asked to create a vector that will express the protein called DCoH in bacteria ( https://www.ncbi.nlm.nih.gov/nuccore/50086629 ).
Target: use pET28b ( https://www.staff.ncl.ac.uk/p.dean/pET28.pdf ) construct the vector so that there are no N-terminal additions and the DCoH protein will have a C-terminal Histidine tag. Be sure to CLEARLY identify:
a) the sequence of your primers
b) the melting temperature of each of your primers
c) the restriction enzymes you plan to use with the sequences underlined in your primers d) will your construct result in the production of C-terminally Histidine-tagged DCoH? prove it by in silico translating the last 2 codons of DCoH along with the rest of your tag
Explanation / Answer
Answer:
a. Nco1 and Xho1 are 0 cutters, i.e, they can be used for cloning. (The restriction sites have been underlined)
Forward primer: 5' cgg ccatgg atggctggcaaagcacaca ggc 3'
Reverse primer: 5' cc ctcgag tgtcatggacactgctacttgttcg 3'
(No STOP codon in the reverse primer, since the his-tag at the C-terminal is to be transcribed)
b. Melting temperatures:
Forward primer: 69.36 (degree C)
Reverse primer: 64.24 (degree C)
c. Performing the translation with Expasy translate, we get:
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.