25. Which letter represents the most recent terminal taxa \'B and \'E\'? common

Question

25. Which letter represents the most recent terminal taxa 'B and 'E'? common ance stor of the monophyletic group ho ?) ? b) Y c) z d) Y or Z e) None of the above. 26. What type of phylogenetic grouping would 'BCD constitute? a) Monophyletic b) Polyphyletic c) Paraphyletic d) Two of the above may be applicable. e) None of the above. Questions 27-29 are based on the phylogeny and associated data matrix belown Anacardiun occidentale ACCGTGANCTGGCATACAAGA Mangifena indica ACCETEACTISCATAGANG Antrocacyan amazanicum ACCGTGAACTGCCATACATAGA Begia nitide ACCGTGAACTGCCATACATAGA Rhus arometice ACCGTGNACTGGCATACATAGA Bucsana (ancestor) ACGGTGAACTSGCATACATAG Mangifera indice Pegie nitids 27. What is the synapomorphy that defines node "X'? a) A transition from DNA nucleotide C to nucleotide G at sequence position 2. b) A transition from DNA nucleotide A to nucleotide T at sequence position 3 c) A transition from DNA nucleotide G to nucleotide C at sequence position 1. d) Both (a) and (b). e) None of the above. 5

Explanation / Answer

25 Ans a): X represent the most recent ancestor of the taxa B&E

26 Ans a): BCD belongs to Monophyletic group

27 Ans c): A trnsition from DNA nucleotide G to nucleotide C at sequence position 1

Related Questions

Navigate

• Browse (All)
• Browse 2
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.