The partial sequence of one strand of a double-stranded DNA molecule is shown be
ID: 312522 • Letter: T
Question
The partial sequence of one strand of a double-stranded DNA molecule is shown below: 5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG-3' Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above. The cleavage sites for the restriction enzymes EcoRI and PstI are shown below. How would you go about cloning this fragment into a plasmid? Use a diagram.Explanation / Answer
1 a)
5'--GACGAAGTGCTGCA^GAAAGTCCGCGTTATAGGCATG^AATTCCTGAGG --3'
3'--CTGCTTCACG^ACGTCTTTCAGGCGCAATATCCGTACTTAA^GGACTCC--5'
After digestion, the product is- 5'---GAAAGTCCGCGTTATAGGCATG---3'
3'-----ACGTCTTTCAGGCGCAATATCCGTACTTAA-----5'
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.