Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Pinal Esamination 11) Triacylglycerols are composed of a) a plycerol backbone. b

ID: 303080 • Letter: P

Question

Pinal Esamination 11) Triacylglycerols are composed of a) a plycerol backbone. b) three fatty acids c) amide linkages between the fatty acids and the Elycerol. d) A and B above. e) A, B, and C above. 12) The major class of lipids found in mammalian cell membranes a) Phosphoglycerides b) Sphingolipids c) Cholesterol d) Glycolipids e) Triacylglycerides 13) In cells, the primary function(s) of deoxyribonucleotides is (are): a) Synthesis of RNA b) Synthesis of DNA c) Cellular energy d) Aand C e) B and C 14) What would be the complementary strand for the following DNA sequence 5 GACATACCCAGACGGTATATTGA 3 a) 5 CTGTATCCCAGACGGATATAACT 3 b) 5 TCAATATACCGTCTGGGTATGTC 3 c) 5 CTGTATGGGTCTGCCATATAACT 3 d) 5 AGTTATATGGCAGACCCATACAG 3 e) 5 TCAATATAGGCAGACCCTATGTC3 15) DNA has approximately nucleotides per turn of B form DNA a) 4.3 b) 9 c) 10.4 d) 11 e) 12

Explanation / Answer

Answers:-

11:- d) A & B above

Explanation:- Triacylgycerol is made up of one glycerol molecule and three fatty acids. They are held together by ester bond. So option d) is correct.

12:- a) Phosphoglycerides

Explanation:- Major class of lipids found in mammalian cell membrane is phospholipid which is composed of phosphoglycerides and sphingomyelins. So phosphoglycerides is correct option.

13:- b) Synthesis of DNA

Explanation:- Deoxyribonucleotide is composed of 3 components : Deoxyribose sugar, phosphate group and nitrogenous base ( A, T, G & C ). These three components make a unit of DNA. So option b) is correct answer.

14:- c) 5' CTGTATGGGTCTGCCATATAACT 3'

Explanation:- Because A binds with T and C binds with G and vice versa. So option c) is correct answer.

15:- c) 10.4

Explanation:- B form of DNA has about 10 - 10.5 base pairs per turn. So option c) is correct answer.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote