Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Your friend (who is a graduate student) is interested in understanding the biolo

ID: 280583 • Letter: Y

Question

Your friend (who is a graduate student) is interested in understanding the biological basis of sleep, and has determined the sequence of a 3 kilobase (i.e., 3000 bases long) mRNA molecule that is highly expressed in the mouse brain when mice are asleep, but not expressed when mice are awake. He has isolated a cDNA from a cDNA library. The sequence from the middle of the cDNA (about 1 kb in) is shown here:

1. Your friend (who is a graduate student) is interested in understanding the biological basis of sleep, and has determined the sequence of a 3 kilobase (i.e., 3000 bases long) mRNA molecule that is highly expressed in the mouse brain when mice are asleep, but not expressed when mice are awake. He has isolated a cDNA from a cDNA library. The sequence from the middle of the cDNA (about 1 kb in) is shown here: 5'- .. .TCGAGCCCTATACTAAACTTGCTACATT...-3' 3 '- .. .AGCTCGGGATATGATTTGAACGATGTAA...-5' a) You want to design a probe that can hybridize to the cDNA molecule above. Circle the molecule(s) below that will hybridize to this cDNA molecule. (6 points) 5 '-CAAGTTTAGT-3' 5'-TCGTTCAAAT-3' 5'-AAATCATATC-3 5'-AGCTCGGGAT-3' 5'-ATAAGTTTTT-3 5'-??????????-3" b) If the sequence of the protein from the portion of the mRNA that is encoded from this bit of cDNA was CSKFSIGL, write the sequence of the mRNA that is produced from this sequence and show how CSKFSIGL is encoded by this mRNA. (4 points) c) If you wanted to use your probe(s) from Part la to do in situ hybridization (meaning, hybridizing to the mRNA in the cell), write the probe(s) that can be used for this below. (3 points) d) If you want to produce this sleep-induced protein in a bacterial expression system, you will need an appropriate promoter. You want to isolate the promoter from a gene that encodes a bacterial protein that would be expressed in all bacterial cells as they grow. Name two proteins that would have promoters that fit this criteria that you could use to cause expression of this sleep-induced protein in bacteria. (5 points)

Explanation / Answer

a) option B and F. both will bind to the complementary sequence and have antiparallel strand.

b) protein sequence - CSKFSIGL

mRNA sequence

5' TGTAGCAAGTTTAGTATAGGGCTC 3'

c) option F.

5' CTATACTAAA 3'

d) sigma factor promoter and T7 promoter.

Dr Jack
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Chat Now And Get Quote