BIOL.2240.011> Week 2 > Assignment 6-DGE Question 18 Answer saved Ponts out of 2

Question

BIOL.2240.011> Week 2 > Assignment 6-DGE Question 18 Answer saved Ponts out of 2.00 P Flag question Help stop RA! Block MMP translation (and thus secretion into the joints) using micrORNA. To block translation, select the correct microRNA that will bind to and block the MMP mRNA molecule shown in the image below. 12 18 polymerase S' AUGCUUAGCAGUGACGUACGAU 3 MRNA 3 UACGAAUCGUCACUGCAUGCUA 5 MRNA TOB Translation Ribosome 187567&page;=17#top 15, AUGCUU AGCAGUGACGUACGAU 3 3 AUGCUUAGCAGUGACGUACGAU 5 5 UACGAAUCGUCACUGCAUGCUA 3

Explanation / Answer

I believe the correct option is already selected as it is complementary to the mRNA so it will bind to it and cleave it to prevent translation.

Feel free to leave a comment down below for any furhter query. Good rating would be appretiated if you find my answer helpful. Thank you.

Related Questions

Navigate

• Browse (All)
• Browse B
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.