Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 GAGGTAGTAATTAGATCTGAAAATTTCACG
ID: 278764 • Letter: P
Question
Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCA GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCA GAGGTAGTAATTAGATCTGAAAATTTCACGAAGAATGCTAAAATCA GAGGTAGTAATTAGATCTGAAAATTTCACGAACAATGCTAAAATCA GAGGTAGTAATTAGATCTGTAAAATTCACGAACAATGCTAAAATCA 8. Based on the alignment above, there are different haplotypes identified here. (Three haplotypes are: ATC, ATG, TAC) a. 2 b. 4 c. 3 d. 5 9. Based on the alignment above, the most common haplotype is a. ATC b. ATG c. TACExplanation / Answer
when a gene group is inherited to next generation which is coming from a single parent, its called haplotype.
8. 2 different types of haplotype
ATG, ATC
9. ATC
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.