You previously diagnosed a patient with a form of cancer that seemed to have H3K

Question

You previously diagnosed a patient with a form of cancer that seemed to have H3K9me3 modifications on the histones at the p53 gene. You gave this patient:a H3K9me3 methyltransferase inhibitor that seemed to stop his cancer growth. 6 months later, this patient comes back to you and the tumor seems to have relapsed and started growing bigger again. You decide to do an RNA-seq profile of his cancer cells and you notice the gene DNMT is highly upregulated (lots of mRNA) 3. A. What is the function of DNMT? And how does DNMT overexpression cause cancer, specifically relating to the p53 gene?. B. Below is a region of the p53 genomic DNA. Clearly circle the nucleotides that could potentially be modified by DNMT. 5" TCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGG ACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAG CTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCACCAGC AGCTCCTACACCGGCGGCCCCTGCACCAGC-3

Explanation / Answer

DNA methyl transferases are the enzymes which catalyse the transfer of methyl group to DNA. The aource used fo methyl group is S- adenosyl methionine. The over expreaaion of DNMT leads to cancer. The P53 are the protiens which suppress the tumour expression genes that forms tumours. So due to over expression DNMT, the DNMT supress tge P53 gene that forma the P53 protiens.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.