3. A research team sequenced a human gene and the corresponding mRNA. Here is th
ID: 269363 • Letter: 3
Question
3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are written using uppercase letters. a) Which parts of that sequence correspond to exons, introns and promoter? b) What is the sequence of the peptide encoded by this gene (first ten residues)? c) What will be the impact of each of the deletions indicated by boxed nucleotides on the protein sequence and length? a) Which parts of that sequence correspond to exons, introns and promoter? b) What is the sequence of the peptide encoded by this gene (first ten residues)? c) What will be the impact of each of the deletions indicated by boxed nucleotides on the protein sequence and length? 3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are written using uppercase letters. agcgaaatttaatgagcgtgtaacaggggactgaaaatcctgatttctcaAGCTATCAAA del 1 GGTTTATAAAGCCAATATCTGGGAAAGAGAAAACCGTGAGACTTCCAGATCTTCTCTGGT GAAGTGTGTTTCCTGCAACGATCACGAACATAAACATCAAAGGATCGCCATGGAAAGgta del 2 agtgtgacaactcactgcgttggtggctcgcgttcttatgagctaagGGTCCCTCCTGCT GCTGCTGGTGTCAAACCTGCTCCTGTGCCAGAGCGTGACCCCCTTGCCCATCTGTCCCGG Del 3 CGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTGTTTGACCGCGCCGTCGTCCTGTC CCACTACATCCATAACCTCTCCTCAGAAATGTTCAGCGAATTCgtaagtaccatgcttct ggcttcctattgaatttgtctcatcatttccagGATAAACGGTATACCCATGGCCGGGGG del 4 TTCATTACCAAGGCCATCAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGA GCAAGCCCAACAGATGAATgtgagtccttcatccaggetttgca a) Which parts of that sequence correspond to exons, introns and promoter? b) What is the sequence of the peptide encoded by this gene (first ten residues)? c) What will be the impact of each of the deletions indicated by boxed nuclcotides on the protein sequence and length?Explanation / Answer
a) Since mRNA or mature mRNA is formed by splicing of pre-mRNA, which inturn is formed by transcription of genomic DNA, has both introns and exons, post splicing of pre-mRNA only exons remain on mRNA. The uppercase letters are exons, since they are common between DNA and mRNA, the lowercase letters after the first stretch of upper case letters are introns, since they are not included in mature mRNA.The promoter is in the first stretch of lower case letters, "tattgaatt" is likely to be the promoter element since it is more than 10 bp upstreams of DNA coding/transcription sequence.
b) The mRNA has a 5' Untranslated region, assuming the start codon here is non-AUG/TAC is UUG or AAC (mRNA), the amino acid sequence is Leu-Leu-Val-Leu-Val-Phe-Val-Val-Ser
c) Del 1 corresponsds to a promoter region, it would unregulate the protein expression,may result in weak or no expression.Del 2 corresponds to initiation codon mutation, wont let protein translation begin. Deletion 3 and 4 will distort the reading frame of the mRNA. If it leads to formation of a stop codon like UGA,UAA,UAG, the protein translation would end there only, else the mutation would distort frame and thus the amino acid sequence.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.