5. This is the DNA sequence for part of the coding strand of the human B-globin

Question

5. This is the DNA sequence for part of the coding strand of the human B-globin gene (CenBank accession number U01317.1) containing an exon (shaded). The sequence is written 5 to 3 from left to right. Suppose you wanted to amplify only the exon by PCR using 20 bp-long primers. Give the sequence of the primers that you would use. (4 points) 28761 ttttttcatc aagttgtttt cggaaactte tactcaacat gcctgtgtgt tattttgtct 20821 tttgcctaac agcto ctcct taacgtgatg gtgattatte teectactca ctttggcaa 28881 a gaagtgca egctgectee cagaagctgg tetctectgt cgccattg tgecccata agtaccactg agttctcttc cagttteca cctecttct gcacatggeg a cttect 21001 21061 gtacatt 21121 ttaaaaggaa aaagtgttca tgggctgagg gatggagaga aacataggaa gaaccaagag ccctgaca cttct gtttaataa aaaaattgca attttatctt ctccatcttt tactcttgtg tte ttcagtaato

Explanation / Answer

Ans) So here in the question , it has asked to design a primer to amplify the exon part (SHADED REGION starting with CTCCTGGGTAACGTGATGGT......and ended with ....GTACATTTTCTTCAGTAATC )

The trick is that for designing forward primer, first 20 bases can be selected directly. No changes required.

So, forward primer = 5' CTCCTGGGTAACGTGATGGT 3'

In case of reverse primer, select the last 20 bases and then do reverse complement of it. That will give you the reverse primer.

So, reverse primer= 5' GATTACTGAAGAAAATGTAC 3'

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.