Problem 17.28 3 of 15 The highlighted sequence shown below is the one originally
ID: 267276 • Letter: P
Question
Problem 17.28 3 of 15 The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E colf. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is shown below without highlighting ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGC TTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCT AAGACTTAA GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGC TCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCC AAGACCCGC Part A Choose the statements that correctly explain the differences between the two sequences. Select the two correct answers. The ATG start codon was added to the 5 end of the recombinant sequence for translation initiation and expression in E. coli, whereas the human sequence is part of the preproinsulin sequence whose ATG start codon is further upstream. The TAA stop codon was added to the 3 end of the recombinant sequence for translation termination in E. colf, whereas the human sequence is part of the preproinsulin sequence whose stop codon is further downstream he third position o many co ons is different rom the natre gene sequence because the pos translat onal mo nca on ofthe pro en pro ct ne?? d er or that n urmans. O The third position of many codons is different from the native gene sequence because the sequence must be unsusceptible to restriction enzymes used in recombinant technology. The third position of many codons is different from the native gene sequence because it was selected with an eye toward codons preferred by E. col Submit Request AnswerExplanation / Answer
option A and E are correct.
ATG start codon was added to the 5' end of the recombinant sequence for translation initiation and expression in E. coli, whereas human sequence is part of preproinsulin sequence whose ATG start codon is further upstream.
the third position of many codons is different from the native gene sequence because it was selected with an eye toward codons preferred by E. coli. this is called codon optimization.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.