Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

2. A short fragment of a human gene is shown below. gaaccactca gggtcctgtg gacagc

ID: 261825 • Letter: 2

Question

2. A short fragment of a human gene is shown below.

gaaccactca gggtcctgtg gacagctcac gaattcctag ctgcaatggc tacaggctcc

cggacgtccc tgctcctggc ttttggcctg ctctgcctgc cctggcttca agagggcagt

gccttcccaa ccattccctt atccaggctt tttgacaacg ctatgctccg cgcccatcgt

ctgcaccagc tggcctttga cacctaccag gagtttgaag aagcctatat cccaaaggaa

cagaagtatt cattcctgca gaacccccag acctccctct gtttctcaga gtctattccg

acaccctcca acagggagga aacacaacag aaatccaacc tagagctgct ccgcatctcc

ctgctgctca tccagtcgtg gctggagccc gtgcagttcc tcaggagtgt cttcgccaac

agcctggtgt acggcgcctc tgacagcaac gtctatgacc tcctaaagga cctagaggaa

ggcatccaaa cgctgatggg gaggctggaa gatggcagcc cccggactgg gcagatcttc

aagcagacct acagcaagtt cgacacaaac tcacacaacg atgacgcact actcaagaac

tacgggctgc tctactgctt caggaaggac atggacaagg tcgagacatt cctgcgcatc

gtgcagtgcc gctctgtgga gggcagctgt ggcttctagc tgcccgggtg gcatccgaat

tcctgtgacc cctccccagt gcctctcctg gccctggaag ttgccactcc agtgcccacc

agccttgtcc taataaaatt aagttgcatc aaaa

a. Using a web-based tool such as ORFfinder or Expasy, find the longest open reading frame (ORF), meaning: the largest stretch of sequence starting with a methionine codon where there are encoded amino acids with no stop codons. Remember that the sequence above might be the coding or the non-coding strand. Highlight the start and stop codons in the above sequence.

Explanation / Answer

atg gctacaggctcccggacgtccctgctcctggcttttggcctgctctgcctgccctgg cttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatg ctccgcgcccatcgtctgcaccagctggcctttgacacctaccaggagtttgaagaagcc tatatcccaaaggaacagaagtattcattcctgcagaacccccagacctccctctgtttc tcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagag ctgctccgcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcagg agtgtcttcgccaacagcctggtgtacggcgcctctgacagcaacgtctatgacctccta aaggacctagaggaaggcatccaaacgctgatggggaggctggaagatggcagcccccgg actgggcagatcttcaagcagacctacagcaagttcgacacaaactcacacaacgatgac gcactactcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgag acattcctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttc tag

Start codon is ATG and stop codon is TAG. It is highlighted in the ORF. THe longest ORF starts at 46 and ends at 699. This codes for 217 amino acids.