Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

6. Below is a piece of DNA that carries part of a gene that codes for an enzyme

ID: 259122 • Letter: 6

Question

6. Below is a piece of DNA that carries part of a gene that codes for an enzyme in central metabolism. The indicated sequence contains the start but not the end of the coding sequence. The schematically represented tRNA reads the codon it is lined up with in the diagram. The boxed sequences and/or components of the figure emphasize concepts you should be familiar with and be able to name and indicate what role they play in the expression and/or translation of a gene.

#6 #3 #7 5' xxxxxXTACGATGTAGTCAGTTCGATCGATCATCACATxxxxx 3DNA #4 #8 #5 GUU #1 #10 K #11 #2 protein #97

Explanation / Answer

#1 Stop codon- This is the place where translation stops

#2- Start codon- This is the place where translation from mRNA to protein starts

#3 The Antisense strand- the strand of DNA used as a template for transcription from 3' to 5'

#4 The sense strand or coding strand: The sequence of DNA with the similar sequence to the transcription product mRNA

#5 & #7 3 prime end of a DNA: contains an exposed -OH at 3 prime region of the neucleotide

#6 & #8 5 prime end of the DNA- contains a exposed phosphate group at five prime position of the ribose sugar of the neucleotide.

#9 Amino acid: The amino acid carried by tRNA during translation

#10 guanine base of anticodon

#11 uracil base of anticodon

a) transcription

b) translation

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote