12. Pretend that you discovered a gene that makes students do poorly on exams. Y

Question

12. Pretend that you discovered a gene that makes students do poorly on exams. Your goal is to remove it from the genome. a) (4 pts) The following is the template DNA of the gene. Transcribe this DNA and write out the resulting RNA left to right 5' to 3 5' AGAGGTTGACTCTGTTTCAGTCGCATGGAT 3 b) (4 pts) Translate the RNA sequence above using the Genetic Code on the last page. Use the single e of the gene, so no start codon is necessary. c) (9 pts) You developed a successful gene knockout system that can remove this gene. Now you want to test whether the above protein is expressed. What technology would you used to test whether the protein is expressed? State the technology and briefly describe how the technology works.

Explanation / Answer

12. mRNA produced will have following sequence -

5'AUCCAUGCGACUGAAACAGAGUCAACCUCU3'

Mature mRNA produced will be translated into IHATETESTS

Protein produced may be identified by westron blotting technique. In this technique protein are separated according to molecular weight and detection of particular protein may done by using molecular probe hybridisation.

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.