30. Which TWO modifications of heterogenous nuclear RNA is important for the sta

Question

30. Which TWO modifications of heterogenous nuclear RNA is important for the stability of the transcription and for its translation?

31. Below is a sequence of a heterogenous nuclear RNA with exons shaded grey and nucleotides that are important for splicing indicated in bold.

...cacccggctcccgcttcacctggggcacagtgcaggtggtcacaggccaagcgggcacgcccactgtgccccccgaccccagcccacagg

   ctcctgtccctgcccactcagcttcaaggcct…

Which cis-acting elements come into close proximity to form the lariat during splicing?

Extra credit: What is the protein that is translated from the mRNA indicated in questions 25 and 26 and what is its general function (hint: you will need to use one of the algorithms found on the NCBI website)?

Explanation / Answer

30. The two modifications are processing and splicing:

Heteronuclear RNA Processing: 5' Processing involves the addition of 7-methylguanosine (m7G) to 5'-end of the heteronuclear-RNA. The process is called capping. 3' Processing involves the addition of adenine residues (~250) after cleavage at 3'-end. The process is called polyadenylation.

Alternate Splicing: It is the process in which non-coding regions called introns removed from the transcript RNA and coding regions called exons are reconnected to form a single molecule.

31. Uridine branch acceptor is the cis-acting element which comes into close proximity to form the lariat during splicing as the nucleotides highlighted in bold are U2 type intronic sites.

Related Questions

Navigate

• Browse (All)
• Browse 3
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.