24. TBP is a protein subunit of the general transcription factor TFIID. What is
ID: 254161 • Letter: 2
Question
24. TBP is a protein subunit of the general transcription factor TFIID. What is the term (acronym) used to name the other protein subunits found in TFIID?
25. The sequence below represents a 5’ region of a particular mRNA (assume that the t’s are u’s), containing a portion of the 5’UTR and the ORF:
5’…gacggactgttctatgactgcaaagatggaa…
Taking into account the function of the start codon, what would by the amino acid sequence produced from the above portion of mRNA?
26. The sequence below represents a 3’ region of the same mRNA as above (assume that the t’s are u’s), containing an in frameportion of the ORF and the 3’UTR:
5’…cagttgcaaacattttgaagagagaccgt
Taking into account the function of stop codons, what would by the amino acid sequence produced from the above portion of mRNA?
Explanation / Answer
24. TAFs (TBP associated factors) are the other protein subunits of the TFIID complex which are about 12 in number.
25. By substituting T's for U's, the sequence can be written as
5'...GACGGACUGUUCUAUGACUGCAAAGAUGGAA..
The first intiation codon AUG encountered is shown in bold letters and intiation will start with Met aminoacid
The aminoacid sequence will be as Met-Thr-Ala-Lys-Met-Glu...
26. Again by substituting T's for U's, we can write the sequence as
...CAGUUGCAAACAUUUUGAAGAGAGACCGT
The stop codon in the sequence is UGA which is shown in bold letters.
The aminoacid sequence will be as ...Gln-Leu-Gln-Thr-Phe
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.